Incidental Mutation 'R1319:Bbs10'
ID 157638
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene Name Bardet-Biedl syndrome 10 (human)
Synonyms
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1319 (G1)
Quality Score 155
Status Not validated
Chromosome 10
Chromosomal Location 111298679-111301727 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111298874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 51 (L51P)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
AlphaFold Q9DBI2
Predicted Effect probably damaging
Transcript: ENSMUST00000040454
AA Change: L51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: L51P

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
chalky UTSW 10 111299761 missense probably damaging 1.00
wampum UTSW 10 111300013 missense probably damaging 1.00
R0097:Bbs10 UTSW 10 111298844 missense probably damaging 1.00
R0117:Bbs10 UTSW 10 111299333 missense possibly damaging 0.94
R0189:Bbs10 UTSW 10 111301065 missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111300052 missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111299383 missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111299257 missense probably damaging 1.00
R2015:Bbs10 UTSW 10 111300855 nonsense probably null
R2361:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3716:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3717:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4407:Bbs10 UTSW 10 111299859 missense probably benign 0.00
R4583:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4607:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4607:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4608:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4609:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4646:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4647:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4648:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4730:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4822:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4832:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R5056:Bbs10 UTSW 10 111300540 missense probably benign 0.00
R6285:Bbs10 UTSW 10 111299761 missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111301104 missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111299449 missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111300767 nonsense probably null
R7376:Bbs10 UTSW 10 111299250 missense probably benign 0.08
R7701:Bbs10 UTSW 10 111300013 missense probably damaging 1.00
R8146:Bbs10 UTSW 10 111300535 missense probably benign 0.05
R8260:Bbs10 UTSW 10 111300243 nonsense probably null
R8832:Bbs10 UTSW 10 111300405 nonsense probably null
Z1176:Bbs10 UTSW 10 111298908 critical splice donor site probably null
Z1176:Bbs10 UTSW 10 111299657 missense probably benign 0.26
Z1176:Bbs10 UTSW 10 111301124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAAAGCTACTGCTCTTCCGC -3'
(R):5'- GTGACTGGAAACACACGCCACTATC -3'

Sequencing Primer
(F):5'- TGACCTAACGGAAGCGTTAC -3'
(R):5'- AGGCACACAGATTGTCCTTTTG -3'
Posted On 2014-02-18