Incidental Mutation 'R1319:Ang2'
ID 157643
Institutional Source Beutler Lab
Gene Symbol Ang2
Ensembl Gene ENSMUSG00000047894
Gene Name angiogenin, ribonuclease A family, member 2
Synonyms Rnase5b, Angrp
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1319 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 51195324-51199148 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51195707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 73 (T73A)
Ref Sequence ENSEMBL: ENSMUSP00000154100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051274] [ENSMUST00000228835]
AlphaFold Q64438
Predicted Effect probably benign
Transcript: ENSMUST00000051274
AA Change: T73A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062902
Gene: ENSMUSG00000047894
AA Change: T73A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
RNAse_Pc 26 142 3.11e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228835
AA Change: T73A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Ang2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:Ang2 UTSW 14 51195518 missense probably damaging 0.98
R1548:Ang2 UTSW 14 51195533 nonsense probably null
R3736:Ang2 UTSW 14 51195656 nonsense probably null
R4329:Ang2 UTSW 14 51195868 missense possibly damaging 0.77
R4754:Ang2 UTSW 14 51195517 missense probably damaging 1.00
R5457:Ang2 UTSW 14 51195835 missense probably damaging 1.00
R7718:Ang2 UTSW 14 51195760 missense probably benign
R8317:Ang2 UTSW 14 51195892 missense probably benign 0.34
R8325:Ang2 UTSW 14 51195503 missense probably damaging 1.00
R8725:Ang2 UTSW 14 51195539 missense probably benign 0.40
R8727:Ang2 UTSW 14 51195539 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAAGTGGACAGGCCAGCCATTCTC -3'
(R):5'- CCTTGGCAGGAATCTCTGTTGGAAG -3'

Sequencing Primer
(F):5'- GCCAGCCATTCTCACAGC -3'
(R):5'- GATGAGCCCAGGTCCTTTG -3'
Posted On 2014-02-18