Mutagenetix > Incidental Mutation

Incidental Mutation 'R1320:Adamts13'

157653

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

039386-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R1320 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26863428-26899640 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26879258 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 604 (I604F)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]

AlphaFold

Q769J6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014996
AA Change: I604F

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: I604F

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	2.3e-11	PFAM
Pfam:Reprolysin	84	291	1e-15	PFAM
Pfam:Reprolysin_3	113	237	2e-10	PFAM
Pfam:Reprolysin_2	132	281	5e-9	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102891
AA Change: I604F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: I604F

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.5%
20x: 87.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	C	T	15: 81,779,394 (GRCm39)	S33L	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Or52d1	A	G	7: 103,755,687 (GRCm39)	D67G	probably damaging	Het
Pole	AGGGG	AGGG	5: 110,456,995 (GRCm39)		probably null	Het
Psmg2	G	A	18: 67,777,391 (GRCm39)	V24I	probably damaging	Het
R3hdm1	G	A	1: 128,159,142 (GRCm39)	R939H	probably benign	Het
Sp140	T	C	1: 85,563,329 (GRCm39)		probably null	Het
Stim1	T	G	7: 102,057,613 (GRCm39)	I142S	possibly damaging	Het
Tanc2	T	A	11: 105,777,270 (GRCm39)	I816N	probably damaging	Het
Ttn	C	T	2: 76,560,859 (GRCm39)	D29181N	probably damaging	Het
Usp32	T	C	11: 84,908,619 (GRCm39)	N1029S	probably damaging	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	26,895,373 (GRCm39)	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26,863,567 (GRCm39)	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	26,895,202 (GRCm39)	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26,873,054 (GRCm39)	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	26,896,206 (GRCm39)	missense	probably benign
IGL01860:Adamts13	APN	2	26,868,023 (GRCm39)	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26,886,595 (GRCm39)	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26,880,610 (GRCm39)	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26,875,495 (GRCm39)	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26,879,295 (GRCm39)	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26,868,687 (GRCm39)	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26,873,049 (GRCm39)	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26,882,973 (GRCm39)	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26,863,631 (GRCm39)	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26,881,432 (GRCm39)	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26,868,711 (GRCm39)	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26,873,986 (GRCm39)	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26,886,933 (GRCm39)	splice site	probably benign
R0276:Adamts13	UTSW	2	26,865,772 (GRCm39)	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26,877,001 (GRCm39)	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26,871,092 (GRCm39)	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	26,895,198 (GRCm39)	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26,876,691 (GRCm39)	splice site	probably null
R0553:Adamts13	UTSW	2	26,881,346 (GRCm39)	nonsense	probably null
R0714:Adamts13	UTSW	2	26,876,997 (GRCm39)	splice site	probably benign
R0862:Adamts13	UTSW	2	26,896,336 (GRCm39)	critical splice donor site	probably null
R1458:Adamts13	UTSW	2	26,878,366 (GRCm39)	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26,871,765 (GRCm39)	nonsense	probably null
R1491:Adamts13	UTSW	2	26,868,327 (GRCm39)	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26,865,687 (GRCm39)	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26,886,595 (GRCm39)	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26,881,306 (GRCm39)	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26,874,153 (GRCm39)	missense	probably damaging	1.00
R2001:Adamts13	UTSW	2	26,864,002 (GRCm39)	missense	probably benign
R2072:Adamts13	UTSW	2	26,895,437 (GRCm39)	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	26,896,326 (GRCm39)	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26,868,374 (GRCm39)	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	26,894,794 (GRCm39)	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	26,894,794 (GRCm39)	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	26,895,412 (GRCm39)	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	26,898,723 (GRCm39)	nonsense	probably null
R4785:Adamts13	UTSW	2	26,873,054 (GRCm39)	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26,873,142 (GRCm39)	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26,879,414 (GRCm39)	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26,876,622 (GRCm39)	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26,886,922 (GRCm39)	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26,886,927 (GRCm39)	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26,883,020 (GRCm39)	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26,876,570 (GRCm39)	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26,863,651 (GRCm39)	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26,886,761 (GRCm39)	missense	probably benign
R5890:Adamts13	UTSW	2	26,876,603 (GRCm39)	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	26,894,898 (GRCm39)	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26,865,762 (GRCm39)	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	26,896,275 (GRCm39)	nonsense	probably null
R7207:Adamts13	UTSW	2	26,868,707 (GRCm39)	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26,879,310 (GRCm39)	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	26,896,326 (GRCm39)	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26,879,336 (GRCm39)	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26,863,965 (GRCm39)	missense	probably benign
R7604:Adamts13	UTSW	2	26,895,218 (GRCm39)	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26,880,597 (GRCm39)	missense	not run
R7814:Adamts13	UTSW	2	26,886,561 (GRCm39)	missense	probably benign
R8076:Adamts13	UTSW	2	26,880,624 (GRCm39)	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26,880,568 (GRCm39)	missense	probably damaging	1.00
R8526:Adamts13	UTSW	2	26,868,012 (GRCm39)	missense	probably benign
R9112:Adamts13	UTSW	2	26,880,379 (GRCm39)	missense	possibly damaging	0.60
R9147:Adamts13	UTSW	2	26,883,024 (GRCm39)	missense	probably benign
R9148:Adamts13	UTSW	2	26,883,024 (GRCm39)	missense	probably benign
R9704:Adamts13	UTSW	2	26,895,237 (GRCm39)	missense
R9743:Adamts13	UTSW	2	26,895,491 (GRCm39)	critical splice donor site	probably null
R9743:Adamts13	UTSW	2	26,886,812 (GRCm39)	missense	probably benign	0.16
X0027:Adamts13	UTSW	2	26,875,558 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATGGCAGAAGTCACAATCCTCACC -3'
(R):5'- TCCCCGGATGTGAATCTCCTCTAAG -3'

Sequencing Primer
(F):5'- TTTGAAGCCTTGGAAGGAGC -3'
(R):5'- AATCTCCTCTAAGTGGGGCAG -3'

Posted On

2014-02-18