Incidental Mutation 'R1320:Olfr646'
ID 157662
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Name olfactory receptor 646
Synonyms GA_x6K02T2PBJ9-6841330-6842268, MOR33-2
MMRRC Submission 039386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R1320 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104104873-104109766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104106480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 67 (D67G)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
AlphaFold Q8VGW2
Predicted Effect probably damaging
Transcript: ENSMUST00000098182
AA Change: D67G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: D67G

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214099
AA Change: D67G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214291
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Adamts13 A T 2: 26,989,246 I604F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Pole AGGGG AGGG 5: 110,309,129 probably null Het
Psmg2 G A 18: 67,644,321 V24I probably damaging Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Sp140 T C 1: 85,635,608 probably null Het
Stim1 T G 7: 102,408,406 I142S possibly damaging Het
Tanc2 T A 11: 105,886,444 I816N probably damaging Het
Ttn C T 2: 76,730,515 D29181N probably damaging Het
Usp32 T C 11: 85,017,793 N1029S probably damaging Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
PIT4402001:Olfr646 UTSW 7 104106450 missense probably damaging 1.00
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R5486:Olfr646 UTSW 7 104106498 missense probably damaging 0.99
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6497:Olfr646 UTSW 7 104107215 intron probably benign
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7766:Olfr646 UTSW 7 104106994 nonsense probably null
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7844:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
R8888:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R8895:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R9167:Olfr646 UTSW 7 104107219 makesense probably null
R9178:Olfr646 UTSW 7 104106513 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCGAAAGTCTCCCAGTCACTCTC -3'
(R):5'- GCCTAGCAATGCCCATATGCTCAC -3'

Sequencing Primer
(F):5'- CAGTCACTCTCTTCCTAACTGG -3'
(R):5'- TCCCAGCAAAGATAATTTGGGC -3'
Posted On 2014-02-18