Incidental Mutation 'R1321:Galnt13'
ID157670
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55098594 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 476 (R476Q)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect probably damaging
Transcript: ENSMUST00000068595
AA Change: R476Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: R476Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112634
AA Change: R512Q

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: R512Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112635
AA Change: R476Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: R476Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112636
AA Change: R476Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: R476Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Meta Mutation Damage Score 0.3451 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGGCAAGACCATCAGAGAGG -3'
(R):5'- GATATGCTGAGAAGGGATTGCTCAGAC -3'

Sequencing Primer
(F):5'- GATTTGAAACCACATGGCTAGGATAC -3'
(R):5'- AAGTATCCTCCTGTTAGTCTTATTGG -3'
Posted On2014-02-18