Incidental Mutation 'R1321:Cass4'
ID157671
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission 039387-MU
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172424652 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 205 (L205Q)
Ref Sequence ENSEMBL: ENSMUSP00000104764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably benign
Transcript: ENSMUST00000099061
AA Change: L205Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570
AA Change: L205Q

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103073
AA Change: L205Q

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: L205Q

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109136
AA Change: L205Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: L205Q

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138288
Predicted Effect probably benign
Transcript: ENSMUST00000228775
AA Change: L205Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAATGAATCACGACTACCAGCCAC -3'
(R):5'- TGGGGACCCTGCACCTGAG -3'

Sequencing Primer
(F):5'- ctcaaactcagaaatccgcc -3'
(R):5'- ccctctcttctctcttctctttg -3'
Posted On2014-02-18