Incidental Mutation 'R1321:Sppl3'
ID157679
Institutional Source Beutler Lab
Gene Symbol Sppl3
Ensembl Gene ENSMUSG00000029550
Gene Namesignal peptide peptidase 3
SynonymsUsmg3, 4833416I09Rik
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R1321 (G1)
Quality Score168
Status Validated
Chromosome5
Chromosomal Location115011137-115098790 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGG to TG at 115088293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031530] [ENSMUST00000128590]
Predicted Effect probably null
Transcript: ENSMUST00000031530
SMART Domains Protein: ENSMUSP00000031530
Gene: ENSMUSG00000029550

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PSN 64 361 1.96e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128590
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit growth retardation, decreased fertility and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Sppl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Sppl3 APN 5 115074876 missense probably benign
IGL02302:Sppl3 APN 5 115082331 missense probably benign 0.43
IGL02381:Sppl3 APN 5 115074910 splice site probably null
IGL02592:Sppl3 APN 5 115095911 missense probably damaging 1.00
IGL02963:Sppl3 APN 5 115061603 missense probably damaging 1.00
R0119:Sppl3 UTSW 5 115088994 unclassified probably benign
R0299:Sppl3 UTSW 5 115088994 unclassified probably benign
R0827:Sppl3 UTSW 5 115082333 nonsense probably null
R1141:Sppl3 UTSW 5 115088293 frame shift probably null
R1322:Sppl3 UTSW 5 115088293 frame shift probably null
R1451:Sppl3 UTSW 5 115088365 missense probably damaging 1.00
R3110:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R3112:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R4701:Sppl3 UTSW 5 115103313 unclassified probably null
R4808:Sppl3 UTSW 5 115083426 splice site probably benign
R4931:Sppl3 UTSW 5 115082314 missense probably damaging 1.00
R6513:Sppl3 UTSW 5 115095936 missense probably damaging 1.00
R6993:Sppl3 UTSW 5 115082290 missense probably damaging 0.99
R7326:Sppl3 UTSW 5 115082335 missense probably damaging 0.99
R7384:Sppl3 UTSW 5 115061641 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATGCTGTGACCTACCTCACACC -3'
(R):5'- GCCAGGATGCCCATACATGACTAAG -3'

Sequencing Primer
(F):5'- ACCCTAGCAGGTCCTGGTG -3'
(R):5'- TCAATCACCTCAGACTGTCGG -3'
Posted On2014-02-18