Incidental Mutation 'R1321:C2cd2l'
ID157684
Institutional Source Beutler Lab
Gene Symbol C2cd2l
Ensembl Gene ENSMUSG00000032120
Gene NameC2 calcium-dependent domain containing 2-like
Synonyms1300006O23Rik, Tmem24
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44309237-44320285 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44317581 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065080] [ENSMUST00000213160] [ENSMUST00000214602] [ENSMUST00000216222]
Predicted Effect probably null
Transcript: ENSMUST00000065080
SMART Domains Protein: ENSMUSP00000065233
Gene: ENSMUSG00000032120

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
SCOP:d1qasa2 284 408 4e-3 SMART
Blast:C2 287 395 9e-62 BLAST
low complexity region 417 430 N/A INTRINSIC
low complexity region 444 452 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
low complexity region 566 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213818
Predicted Effect probably null
Transcript: ENSMUST00000214602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214915
Predicted Effect probably benign
Transcript: ENSMUST00000216222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216855
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in C2cd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:C2cd2l APN 9 44317103 missense probably damaging 1.00
IGL01304:C2cd2l APN 9 44319587 missense probably damaging 0.96
IGL02402:C2cd2l APN 9 44316581 missense probably benign 0.31
R0701:C2cd2l UTSW 9 44316202 missense probably damaging 1.00
R0883:C2cd2l UTSW 9 44316202 missense probably damaging 1.00
R1594:C2cd2l UTSW 9 44316773 missense probably damaging 1.00
R1665:C2cd2l UTSW 9 44316775 missense probably benign 0.07
R1700:C2cd2l UTSW 9 44316612 missense probably benign 0.00
R1739:C2cd2l UTSW 9 44319743 missense probably benign 0.26
R1770:C2cd2l UTSW 9 44316811 missense probably benign 0.02
R2065:C2cd2l UTSW 9 44316335 missense probably benign 0.19
R4669:C2cd2l UTSW 9 44315025 missense possibly damaging 0.92
R4835:C2cd2l UTSW 9 44315145 critical splice donor site probably null
R4890:C2cd2l UTSW 9 44311133 missense probably damaging 1.00
R4916:C2cd2l UTSW 9 44316560 missense probably damaging 0.97
R5664:C2cd2l UTSW 9 44313772 missense probably damaging 1.00
R6268:C2cd2l UTSW 9 44317666 missense probably damaging 1.00
R6339:C2cd2l UTSW 9 44313491 splice site probably benign
R7043:C2cd2l UTSW 9 44316551 missense probably damaging 1.00
R7236:C2cd2l UTSW 9 44317663 missense possibly damaging 0.71
R7532:C2cd2l UTSW 9 44315384 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGCAGCACCTGAAACAGGGAAC -3'
(R):5'- TCAAGCCAGCAATTGGGCAGAC -3'

Sequencing Primer
(F):5'- gaggcagaggcaggcag -3'
(R):5'- CTCCATCCAAATCGCCTTTG -3'
Posted On2014-02-18