Incidental Mutation 'R1321:Lgr5'
ID157691
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission 039387-MU
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115478457 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 192 (T192A)
Ref Sequence ENSEMBL: ENSMUSP00000133860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect probably damaging
Transcript: ENSMUST00000020350
AA Change: T192A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: T192A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149008
Predicted Effect probably damaging
Transcript: ENSMUST00000172806
AA Change: T192A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: T192A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173740
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Meta Mutation Damage Score 0.2147 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R3910:Lgr5 UTSW 10 115587463 missense possibly damaging 0.93
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5375:Lgr5 UTSW 10 115478564 missense probably benign 0.00
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6605:Lgr5 UTSW 10 115457867 missense possibly damaging 0.69
R6689:Lgr5 UTSW 10 115466608 missense probably damaging 0.99
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7458:Lgr5 UTSW 10 115457755 critical splice donor site probably null
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
R7770:Lgr5 UTSW 10 115471994 missense probably damaging 0.98
R7936:Lgr5 UTSW 10 115453047 missense probably damaging 0.99
R7964:Lgr5 UTSW 10 115452174 missense probably benign 0.00
R8085:Lgr5 UTSW 10 115475197 missense probably benign
R8537:Lgr5 UTSW 10 115452402 missense probably damaging 1.00
R8703:Lgr5 UTSW 10 115452705 missense probably benign 0.01
R8704:Lgr5 UTSW 10 115452705 missense probably benign 0.01
R8706:Lgr5 UTSW 10 115452705 missense probably benign 0.01
R8707:Lgr5 UTSW 10 115452705 missense probably benign 0.01
Z1176:Lgr5 UTSW 10 115460876 missense probably damaging 0.98
Z1177:Lgr5 UTSW 10 115456669 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCATTCAAGTTTTGAGGTCC -3'
(R):5'- GCTCTGCCTAATGAGCACATGCAAC -3'

Sequencing Primer
(F):5'- TGAGGTCCATCACTTGAAGGC -3'
(R):5'- AGTCTGTCCGCAGCCTAAG -3'
Posted On2014-02-18