Incidental Mutation 'R1321:4930447C04Rik'
ID157692
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene NameRIKEN cDNA 4930447C04 gene
SynonymsSix6as, Six6os1
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72881109-72940774 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 72898544 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489]
Predicted Effect probably benign
Transcript: ENSMUST00000044000
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110489
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132901
Predicted Effect probably benign
Transcript: ENSMUST00000143960
SMART Domains Protein: ENSMUSP00000116391
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 1 70 6.1e-21 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1271:4930447C04Rik UTSW 12 72892883 missense possibly damaging 0.71
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1424:4930447C04Rik UTSW 12 72892895 nonsense probably null
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R5243:4930447C04Rik UTSW 12 72909769 critical splice donor site probably null
R6312:4930447C04Rik UTSW 12 72889767 missense possibly damaging 0.86
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
R7275:4930447C04Rik UTSW 12 72910021 missense possibly damaging 0.71
RF041:4930447C04Rik UTSW 12 72881276 small deletion probably benign
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Z1176:4930447C04Rik UTSW 12 72916726 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGTATGTCCCATTGTTTGCCACAGTTC -3'
(R):5'- AAAAGTTCACAAGGTTTTATGCAATTCAGGt -3'

Sequencing Primer
(F):5'- atgtagtcaaattgggaaatggg -3'
(R):5'- GGATAAAGCTCCACGCTACT -3'
Posted On2014-02-18