Incidental Mutation 'R1322:Sppl3'
ID157710
Institutional Source Beutler Lab
Gene Symbol Sppl3
Ensembl Gene ENSMUSG00000029550
Gene Namesignal peptide peptidase 3
SynonymsUsmg3, 4833416I09Rik
MMRRC Submission 039388-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R1322 (G1)
Quality Score207
Status Not validated
Chromosome5
Chromosomal Location115011137-115098790 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGG to TG at 115088293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031530] [ENSMUST00000128590]
Predicted Effect probably null
Transcript: ENSMUST00000031530
SMART Domains Protein: ENSMUSP00000031530
Gene: ENSMUSG00000029550

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PSN 64 361 1.96e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128590
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit growth retardation, decreased fertility and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Col27a1 A C 4: 63,328,566 probably benign Het
Fam184a G T 10: 53,652,319 D815E probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gpr162 G T 6: 124,858,901 T512K probably damaging Het
Hipk1 A T 3: 103,743,981 S1155R probably damaging Het
Itih2 A G 2: 10,109,522 V417A probably damaging Het
Kmt2a A G 9: 44,821,121 probably benign Het
Mecom G T 3: 29,957,373 P670Q probably damaging Het
Mgat4d A G 8: 83,365,725 T247A possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr830 T C 9: 18,875,521 F65L possibly damaging Het
Polr1c T C 17: 46,244,163 K327R possibly damaging Het
Prpf39 A T 12: 65,042,662 N58I possibly damaging Het
Sh3bp2 T A 5: 34,555,493 N92K probably damaging Het
Tcrg-C3 T C 13: 19,261,194 F104S probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Vmn2r88 T G 14: 51,414,108 I293S probably damaging Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp930 A G 8: 69,228,168 T171A probably benign Het
Other mutations in Sppl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Sppl3 APN 5 115074876 missense probably benign
IGL02302:Sppl3 APN 5 115082331 missense probably benign 0.43
IGL02381:Sppl3 APN 5 115074910 splice site probably null
IGL02592:Sppl3 APN 5 115095911 missense probably damaging 1.00
IGL02963:Sppl3 APN 5 115061603 missense probably damaging 1.00
R0119:Sppl3 UTSW 5 115088994 unclassified probably benign
R0299:Sppl3 UTSW 5 115088994 unclassified probably benign
R0827:Sppl3 UTSW 5 115082333 nonsense probably null
R1141:Sppl3 UTSW 5 115088293 frame shift probably null
R1321:Sppl3 UTSW 5 115088293 frame shift probably null
R1451:Sppl3 UTSW 5 115088365 missense probably damaging 1.00
R3110:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R3112:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R4701:Sppl3 UTSW 5 115103313 unclassified probably null
R4808:Sppl3 UTSW 5 115083426 splice site probably benign
R4931:Sppl3 UTSW 5 115082314 missense probably damaging 1.00
R6513:Sppl3 UTSW 5 115095936 missense probably damaging 1.00
R6993:Sppl3 UTSW 5 115082290 missense probably damaging 0.99
R7326:Sppl3 UTSW 5 115082335 missense probably damaging 0.99
R7384:Sppl3 UTSW 5 115061641 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATGCTGTGACCTACCTCACACC -3'
(R):5'- GCCAGGATGCCCATACATGACTAAG -3'

Sequencing Primer
(F):5'- ACCCTAGCAGGTCCTGGTG -3'
(R):5'- TCAATCACCTCAGACTGTCGG -3'
Posted On2014-02-18