Incidental Mutation 'R1322:Olfr830'
ID157715
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Nameolfactory receptor 830
SynonymsGA_x6K02T2PVTD-12618399-12619337, MOR152-1
MMRRC Submission 039388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1322 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18874693-18878369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18875521 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078861
AA Change: F65L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: F65L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212723
AA Change: F62L

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Col27a1 A C 4: 63,328,566 probably benign Het
Fam184a G T 10: 53,652,319 D815E probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gpr162 G T 6: 124,858,901 T512K probably damaging Het
Hipk1 A T 3: 103,743,981 S1155R probably damaging Het
Itih2 A G 2: 10,109,522 V417A probably damaging Het
Kmt2a A G 9: 44,821,121 probably benign Het
Mecom G T 3: 29,957,373 P670Q probably damaging Het
Mgat4d A G 8: 83,365,725 T247A possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Polr1c T C 17: 46,244,163 K327R possibly damaging Het
Prpf39 A T 12: 65,042,662 N58I possibly damaging Het
Sh3bp2 T A 5: 34,555,493 N92K probably damaging Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Tcrg-C3 T C 13: 19,261,194 F104S probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Vmn2r88 T G 14: 51,414,108 I293S probably damaging Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp930 A G 8: 69,228,168 T171A probably benign Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R1803:Olfr830 UTSW 9 18876080 missense probably damaging 1.00
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4394:Olfr830 UTSW 9 18875611 missense probably damaging 0.98
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6602:Olfr830 UTSW 9 18875849 missense possibly damaging 0.81
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R7780:Olfr830 UTSW 9 18875614 missense possibly damaging 0.65
R8245:Olfr830 UTSW 9 18875830 missense probably benign
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTTGTGATATACTCAGCAGCATTT -3'
(R):5'- CCAGAATAACACAGAAACTGGGGTTCAT -3'

Sequencing Primer
(F):5'- GATAGCAAAAGTAAGTTCACCTCAG -3'
(R):5'- TGTAGCGATCATAAGCCATTACTCC -3'
Posted On2014-02-18