Incidental Mutation 'R1322:Vmn2r88'
ID157721
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission 039388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1322 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 51414108 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 293 (I293S)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably damaging
Transcript: ENSMUST00000022438
AA Change: I301S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: I301S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159674
AA Change: I293S
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: I293S

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163019
AA Change: I268S
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: I268S

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228139
AA Change: I293S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Col27a1 A C 4: 63,328,566 probably benign Het
Fam184a G T 10: 53,652,319 D815E probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gpr162 G T 6: 124,858,901 T512K probably damaging Het
Hipk1 A T 3: 103,743,981 S1155R probably damaging Het
Itih2 A G 2: 10,109,522 V417A probably damaging Het
Kmt2a A G 9: 44,821,121 probably benign Het
Mecom G T 3: 29,957,373 P670Q probably damaging Het
Mgat4d A G 8: 83,365,725 T247A possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr830 T C 9: 18,875,521 F65L possibly damaging Het
Polr1c T C 17: 46,244,163 K327R possibly damaging Het
Prpf39 A T 12: 65,042,662 N58I possibly damaging Het
Sh3bp2 T A 5: 34,555,493 N92K probably damaging Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Tcrg-C3 T C 13: 19,261,194 F104S probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp930 A G 8: 69,228,168 T171A probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 intron probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Predicted Primers PCR Primer
(F):5'- AGTAGCCACCAAGGACACACATTTG -3'
(R):5'- TGTGGGCCACAGCATAAACAGC -3'

Sequencing Primer
(F):5'- GACAAGGGTATTCAGTTTCTCTCAG -3'
(R):5'- AGTGCTGTCCATTCCAATGTG -3'
Posted On2014-02-18