Incidental Mutation 'R1304:Slc35b4'
ID157750
Institutional Source Beutler Lab
Gene Symbol Slc35b4
Ensembl Gene ENSMUSG00000018999
Gene Namesolute carrier family 35, member B4
Synonyms4930474D06Rik
MMRRC Submission 039370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1304 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34153380-34177111 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34163365 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 151 (K151*)
Ref Sequence ENSEMBL: ENSMUSP00000019143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019143] [ENSMUST00000138250]
Predicted Effect probably null
Transcript: ENSMUST00000019143
AA Change: K151*
SMART Domains Protein: ENSMUSP00000019143
Gene: ENSMUSG00000018999
AA Change: K151*

DomainStartEndE-ValueType
Pfam:UAA 2 314 1.7e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126498
Predicted Effect probably benign
Transcript: ENSMUST00000138250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146514
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyltransferases, such as SLC35B4, transport nucleotide sugars from the cytoplasm where they are synthesized, to the Golgi apparatus where they are utilized in the synthesis of glycoproteins, glycolipids, and proteoglycans (Ashikov et al., 2005 [PubMed 15911612]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy2 T G 12: 36,186,805 I204S probably damaging Het
Cdh12 T G 15: 21,583,937 L621R probably benign Het
Dnah9 A G 11: 65,927,588 I3308T probably damaging Het
Dync2h1 A G 9: 7,102,318 L454P probably damaging Het
Ece2 A G 16: 20,611,782 E53G probably damaging Het
Kcp T A 6: 29,501,292 probably benign Het
Lyst C A 13: 13,751,984 Y3458* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1006 T C 2: 85,674,338 D271G probably damaging Het
Olfr1148 C T 2: 87,833,705 T222I possibly damaging Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Plekha1 A G 7: 130,902,219 T219A probably benign Het
Prkdc T A 16: 15,759,723 F2380L probably damaging Het
Tmem241 A G 18: 12,070,078 probably null Het
Zfp607a C A 7: 27,865,575 R56S probably benign Het
Other mutations in Slc35b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Slc35b4 APN 6 34158429 missense probably benign 0.03
IGL01667:Slc35b4 APN 6 34167675 missense possibly damaging 0.81
IGL01670:Slc35b4 APN 6 34170549 missense probably benign 0.00
IGL02015:Slc35b4 APN 6 34170548 missense probably damaging 1.00
IGL02710:Slc35b4 APN 6 34158541 missense probably benign 0.02
IGL03051:Slc35b4 APN 6 34160471 critical splice donor site probably null
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R1052:Slc35b4 UTSW 6 34161684 missense probably damaging 1.00
R1606:Slc35b4 UTSW 6 34158388 nonsense probably null
R1713:Slc35b4 UTSW 6 34170549 missense probably benign 0.00
R1872:Slc35b4 UTSW 6 34158505 nonsense probably null
R5539:Slc35b4 UTSW 6 34176802 missense probably damaging 0.99
R6954:Slc35b4 UTSW 6 34158621 missense probably benign 0.02
R7339:Slc35b4 UTSW 6 34167656 missense probably damaging 1.00
R7560:Slc35b4 UTSW 6 34163361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAGACGTATTGGTCCCAGGTG -3'
(R):5'- TCATGTCAGCAAAGCAGGTGGTAAG -3'

Sequencing Primer
(F):5'- GTCCCAGGTGCCACTCTC -3'
(R):5'- CATTGGGCCGATTATTAGGCAC -3'
Posted On2014-02-18