Incidental Mutation 'R1305:Rcor3'
ID157767
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
MMRRC Submission 039371-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R1305 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 192116346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 312 (V312I)
Ref Sequence ENSEMBL: ENSMUSP00000142054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192222] [ENSMUST00000192491] [ENSMUST00000192866]
Predicted Effect unknown
Transcript: ENSMUST00000073279
AA Change: V312I
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395
AA Change: V312I

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110849
AA Change: V312I
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395
AA Change: V312I

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192128
AA Change: V312I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395
AA Change: V312I

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192158
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192222
AA Change: V1I
Predicted Effect probably benign
Transcript: ENSMUST00000192491
AA Change: V312I

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395
AA Change: V312I

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192866
AA Change: V312I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395
AA Change: V312I

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194750
AA Change: V114I
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,749,184 V306I probably damaging Het
Enc1 T C 13: 97,246,700 Y573H possibly damaging Het
Gm13757 A T 2: 88,446,302 L212* probably null Het
Gm9869 T C 9: 60,821,886 probably benign Het
Ifna2 T C 4: 88,683,377 T135A probably benign Het
Ifngr1 C T 10: 19,606,253 T197M possibly damaging Het
Kcnj4 A T 15: 79,484,819 V320E probably damaging Het
Map2 T A 1: 66,425,395 I1648N probably damaging Het
Map4k1 A T 7: 28,995,465 M435L probably benign Het
Mark3 T A 12: 111,615,446 probably null Het
Mex3c T A 18: 73,590,235 F466L probably benign Het
Msl3l2 T C 10: 56,115,535 C119R probably damaging Het
Msln T C 17: 25,753,027 E72G probably benign Het
Nid2 T C 14: 19,768,862 S475P probably benign Het
Nme8 T A 13: 19,696,907 N18I possibly damaging Het
Nwd2 G T 5: 63,745,197 W86L probably damaging Het
Olfr1353 T C 10: 78,970,099 I150T probably benign Het
Pard3 T A 8: 127,306,410 S162T possibly damaging Het
Ppm1a C A 12: 72,783,720 D6E probably damaging Het
Rgs20 T A 1: 5,021,039 probably null Het
Slc11a2 C A 15: 100,410,082 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Vmn1r124 C A 7: 21,260,263 V119F probably benign Het
Zfp827 A G 8: 79,060,894 T230A possibly damaging Het
Zfp945 T C 17: 22,852,386 K180E probably damaging Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4403:Rcor3 UTSW 1 192119912 splice site probably null
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5219:Rcor3 UTSW 1 192137513 utr 5 prime probably benign
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7402:Rcor3 UTSW 1 192127983 missense probably benign 0.00
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7432:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
R7729:Rcor3 UTSW 1 192101778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCAAAGGGACCAGCGTAGAC -3'
(R):5'- TTCCAGGAGTGAAGCTCAGCTCAG -3'

Sequencing Primer
(F):5'- AGCGTAGACCCCGAGACTG -3'
(R):5'- GTCCTGTCAATCTGCCAAAGTATG -3'
Posted On2014-02-18