Incidental Mutation 'R1305:Enc1'
ID157785
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Nameectodermal-neural cortex 1
SynonymsNrpb, PIG10
MMRRC Submission 039371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1305 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97241105-97253034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97246700 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 573 (Y573H)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041623
AA Change: Y573H

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: Y573H

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,749,184 V306I probably damaging Het
Gm13757 A T 2: 88,446,302 L212* probably null Het
Gm9869 T C 9: 60,821,886 probably benign Het
Ifna2 T C 4: 88,683,377 T135A probably benign Het
Ifngr1 C T 10: 19,606,253 T197M possibly damaging Het
Kcnj4 A T 15: 79,484,819 V320E probably damaging Het
Map2 T A 1: 66,425,395 I1648N probably damaging Het
Map4k1 A T 7: 28,995,465 M435L probably benign Het
Mark3 T A 12: 111,615,446 probably null Het
Mex3c T A 18: 73,590,235 F466L probably benign Het
Msl3l2 T C 10: 56,115,535 C119R probably damaging Het
Msln T C 17: 25,753,027 E72G probably benign Het
Nid2 T C 14: 19,768,862 S475P probably benign Het
Nme8 T A 13: 19,696,907 N18I possibly damaging Het
Nwd2 G T 5: 63,745,197 W86L probably damaging Het
Olfr1353 T C 10: 78,970,099 I150T probably benign Het
Pard3 T A 8: 127,306,410 S162T possibly damaging Het
Ppm1a C A 12: 72,783,720 D6E probably damaging Het
Rcor3 C T 1: 192,116,346 V312I possibly damaging Het
Rgs20 T A 1: 5,021,039 probably null Het
Slc11a2 C A 15: 100,410,082 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Vmn1r124 C A 7: 21,260,263 V119F probably benign Het
Zfp827 A G 8: 79,060,894 T230A possibly damaging Het
Zfp945 T C 17: 22,852,386 K180E probably damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97245314 missense probably benign 0.00
IGL02010:Enc1 APN 13 97245080 missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97245534 missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97246470 missense possibly damaging 0.64
R1419:Enc1 UTSW 13 97246184 missense probably damaging 1.00
R1733:Enc1 UTSW 13 97245042 missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97246483 missense probably benign 0.00
R1796:Enc1 UTSW 13 97246485 missense possibly damaging 0.58
R1823:Enc1 UTSW 13 97245978 missense possibly damaging 0.64
R4107:Enc1 UTSW 13 97245138 missense probably damaging 1.00
R4324:Enc1 UTSW 13 97245897 missense probably benign 0.21
R4922:Enc1 UTSW 13 97245735 missense probably benign 0.08
R5942:Enc1 UTSW 13 97246379 missense probably benign 0.28
R5951:Enc1 UTSW 13 97245257 missense probably benign 0.02
R6229:Enc1 UTSW 13 97245491 missense probably benign
R6985:Enc1 UTSW 13 97245120 missense possibly damaging 0.92
R6987:Enc1 UTSW 13 97245636 missense probably benign 0.14
R7307:Enc1 UTSW 13 97245093 missense probably damaging 1.00
R7442:Enc1 UTSW 13 97246740 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGTGACAGCCAAGCGCATGAG -3'
(R):5'- TGGGAGACTCTGAGGTTCAGTGAC -3'

Sequencing Primer
(F):5'- CAAGCGCATGAGCTGCC -3'
(R):5'- aaccactgGTTCCTGTTAAAAGG -3'
Posted On2014-02-18