Incidental Mutation 'R1305:Kcnj4'
ID 157787
Institutional Source Beutler Lab
Gene Symbol Kcnj4
Ensembl Gene ENSMUSG00000044216
Gene Name potassium inwardly-rectifying channel, subfamily J, member 4
Synonyms IRK3, Kcnf2, Kir 2.3, MB-IRK3
MMRRC Submission 039371-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1305 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 79367915-79389442 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79369020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 320 (V320E)
Ref Sequence ENSEMBL: ENSMUSP00000094075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057801]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057801
AA Change: V320E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094075
Gene: ENSMUSG00000044216
AA Change: V320E

DomainStartEndE-ValueType
Pfam:IRK 22 361 2.1e-155 PFAM
coiled coil region 371 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229365
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,887,247 (GRCm39) V306I probably damaging Het
Enc1 T C 13: 97,383,208 (GRCm39) Y573H possibly damaging Het
Gm9869 T C 9: 60,729,168 (GRCm39) probably benign Het
Ifna2 T C 4: 88,601,614 (GRCm39) T135A probably benign Het
Ifngr1 C T 10: 19,482,001 (GRCm39) T197M possibly damaging Het
Map2 T A 1: 66,464,554 (GRCm39) I1648N probably damaging Het
Map4k1 A T 7: 28,694,890 (GRCm39) M435L probably benign Het
Mark3 T A 12: 111,581,880 (GRCm39) probably null Het
Mex3c T A 18: 73,723,306 (GRCm39) F466L probably benign Het
Msl3l2 T C 10: 55,991,631 (GRCm39) C119R probably damaging Het
Msln T C 17: 25,972,001 (GRCm39) E72G probably benign Het
Nid2 T C 14: 19,818,930 (GRCm39) S475P probably benign Het
Nme8 T A 13: 19,881,077 (GRCm39) N18I possibly damaging Het
Nwd2 G T 5: 63,902,540 (GRCm39) W86L probably damaging Het
Or4p21 A T 2: 88,276,646 (GRCm39) L212* probably null Het
Or7a37 T C 10: 78,805,933 (GRCm39) I150T probably benign Het
Pard3 T A 8: 128,032,891 (GRCm39) S162T possibly damaging Het
Ppm1a C A 12: 72,830,494 (GRCm39) D6E probably damaging Het
Rcor3 C T 1: 191,800,646 (GRCm39) V312I possibly damaging Het
Rgs20 T A 1: 5,091,262 (GRCm39) probably null Het
Slc11a2 C A 15: 100,307,963 (GRCm39) probably null Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Vmn1r124 C A 7: 20,994,188 (GRCm39) V119F probably benign Het
Zfp827 A G 8: 79,787,523 (GRCm39) T230A possibly damaging Het
Zfp945 T C 17: 23,071,360 (GRCm39) K180E probably damaging Het
Other mutations in Kcnj4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Kcnj4 APN 15 79,368,780 (GRCm39) missense probably benign 0.01
IGL02263:Kcnj4 APN 15 79,369,988 (GRCm39) utr 5 prime probably benign
IGL02551:Kcnj4 APN 15 79,369,103 (GRCm39) missense probably benign 0.05
R1464:Kcnj4 UTSW 15 79,369,605 (GRCm39) missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79,369,605 (GRCm39) missense probably damaging 1.00
R1475:Kcnj4 UTSW 15 79,368,831 (GRCm39) missense probably damaging 1.00
R1844:Kcnj4 UTSW 15 79,369,216 (GRCm39) missense probably damaging 1.00
R3906:Kcnj4 UTSW 15 79,369,946 (GRCm39) missense probably benign 0.01
R3907:Kcnj4 UTSW 15 79,369,946 (GRCm39) missense probably benign 0.01
R3908:Kcnj4 UTSW 15 79,369,946 (GRCm39) missense probably benign 0.01
R4396:Kcnj4 UTSW 15 79,368,874 (GRCm39) missense probably benign 0.06
R7598:Kcnj4 UTSW 15 79,369,965 (GRCm39) missense probably benign 0.00
R8059:Kcnj4 UTSW 15 79,369,003 (GRCm39) missense probably benign
R8371:Kcnj4 UTSW 15 79,369,342 (GRCm39) missense probably damaging 1.00
R8818:Kcnj4 UTSW 15 79,369,920 (GRCm39) missense probably damaging 1.00
R9664:Kcnj4 UTSW 15 79,369,220 (GRCm39) missense possibly damaging 0.95
X0062:Kcnj4 UTSW 15 79,369,891 (GRCm39) missense probably benign 0.06
Z1177:Kcnj4 UTSW 15 79,369,370 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGCCAAACTCAAGCATCC -3'
(R):5'- GACCTCAACGTGGGCTATGACATC -3'

Sequencing Primer
(F):5'- CCGGATAATGCCTGCCTC -3'
(R):5'- GGTGTCACCCATCATCATAGTG -3'
Posted On 2014-02-18