Mutagenetix > Incidental Mutation

Incidental Mutation 'R1306:Mcm7'

157798

Institutional Source

Beutler Lab

Gene Symbol

Mcm7

Ensembl Gene

ENSMUSG00000029730

Gene Name

minichromosome maintenance complex component 7

Synonyms

mCDC47, Mcmd7

MMRRC Submission

039372-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1306 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138162845-138170675 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 138165465 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 480 (A480S)

Ref Sequence

ENSEMBL: ENSMUSP00000000505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000019662] [ENSMUST00000110951] [ENSMUST00000148879] [ENSMUST00000153867] [ENSMUST00000139983] [ENSMUST00000147920] [ENSMUST00000132639] [ENSMUST00000155902] [ENSMUST00000151318] [ENSMUST00000148094] [ENSMUST00000143241]

AlphaFold

Q61881

Predicted Effect

probably damaging
Transcript: ENSMUST00000000505
AA Change: A480S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730
AA Change: A480S

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	1e-41	BLAST
MCM	145	642	N/A	SMART
AAA	373	526	2.9e-4	SMART
Blast:MCM	658	719	1e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000019638

SMART Domains

Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
JAB_MPN	37	170	9.73e-35	SMART
Pfam:MitMem_reg	191	304	1.1e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000019662

SMART Domains

Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518

Domain	Start	End	E-Value	Type
SCOP:d1gw5m2	1	142	2e-49	SMART
Pfam:Adap_comp_sub	173	449	2.5e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083593

Predicted Effect

probably benign
Transcript: ENSMUST00000110951

SMART Domains

Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
JAB_MPN	10	143	9.73e-35	SMART
Pfam:MitMem_reg	163	279	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125316

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127881

Predicted Effect

probably benign
Transcript: ENSMUST00000148879

SMART Domains

Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	6e-44	BLAST
MCM	145	389	1.77e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153867

SMART Domains

Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	9.5e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139983

SMART Domains

Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	5.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147920

Predicted Effect

probably benign
Transcript: ENSMUST00000132639

SMART Domains

Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
Pfam:MitMem_reg	17	112	3.6e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155902

SMART Domains

Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	5.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151318

SMART Domains

Protein: ENSMUSP00000121338
Gene: ENSMUSG00000019518

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	47	153	3.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148094

SMART Domains

Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Blast:MCM	1	25	4e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000143241

SMART Domains

Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518

Domain	Start	End	E-Value	Type
SCOP:d1gw5m2	1	86	2e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157031

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.1%
20x: 89.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk3	T	A	7: 80,743,621 (GRCm39)	L1146H	probably damaging	Het
Atad2b	A	G	12: 5,024,239 (GRCm39)	I121M	probably benign	Het
Atg2a	A	T	19: 6,303,051 (GRCm39)	T1053S	probably benign	Het
Bend5	C	T	4: 111,316,970 (GRCm39)	Q127*	probably null	Het
Ccser1	G	A	6: 62,357,090 (GRCm39)	D843N	probably damaging	Het
Dennd4b	A	G	3: 90,178,472 (GRCm39)	T512A	probably benign	Het
Dnmbp	A	T	19: 43,890,218 (GRCm39)	D516E	probably benign	Het
Dok3	C	A	13: 55,675,261 (GRCm39)	E86*	probably null	Het
Fat3	A	G	9: 16,287,975 (GRCm39)	I516T	probably damaging	Het
Gabbr1	T	A	17: 37,366,882 (GRCm39)		probably null	Het
Gjd2	T	C	2: 113,842,346 (GRCm39)	T44A	probably damaging	Het
Meox2	GCACCACCACCACCACCACCA	GCACCACCACCACCACCA	12: 37,159,030 (GRCm39)		probably benign	Het
Ntn4	C	T	10: 93,543,215 (GRCm39)	R314W	probably damaging	Het
Pdzph1	T	C	17: 59,239,427 (GRCm39)	H967R	possibly damaging	Het
Pik3c2g	A	G	6: 139,718,154 (GRCm39)	N227S	probably benign	Het
Pkd1	T	C	17: 24,792,146 (GRCm39)	S1278P	probably damaging	Het
Plch2	T	C	4: 155,091,597 (GRCm39)	E71G	probably damaging	Het
Pnma8a	A	G	7: 16,695,950 (GRCm39)	R428G	probably benign	Het
Sertad2	T	C	11: 20,598,388 (GRCm39)	S195P	probably benign	Het
Slc19a3	A	G	1: 83,000,483 (GRCm39)	L178S	probably damaging	Het
Smarca2	A	G	19: 26,748,388 (GRCm39)	D139G	possibly damaging	Het
Tm4sf19	G	A	16: 32,226,720 (GRCm39)	V170M	probably damaging	Het
Vwa3a	C	G	7: 120,399,613 (GRCm39)	S1031R	possibly damaging	Het

Other mutations in Mcm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01649:Mcm7	APN	5	138,167,698 (GRCm39)	missense	probably damaging	1.00
IGL01954:Mcm7	APN	5	138,165,507 (GRCm39)	missense	probably damaging	1.00
IGL02611:Mcm7	APN	5	138,165,701 (GRCm39)	missense	probably damaging	1.00
ANU23:Mcm7	UTSW	5	138,168,653 (GRCm39)	missense	probably benign	0.02
PIT1430001:Mcm7	UTSW	5	138,165,708 (GRCm39)	unclassified	probably benign
R0022:Mcm7	UTSW	5	138,162,981 (GRCm39)	makesense	probably null
R1865:Mcm7	UTSW	5	138,168,637 (GRCm39)	missense	possibly damaging	0.47
R2132:Mcm7	UTSW	5	138,167,364 (GRCm39)	missense	probably damaging	1.00
R3719:Mcm7	UTSW	5	138,164,976 (GRCm39)	nonsense	probably null
R3781:Mcm7	UTSW	5	138,162,998 (GRCm39)	missense	probably damaging	0.99
R3782:Mcm7	UTSW	5	138,162,998 (GRCm39)	missense	probably damaging	0.99
R4724:Mcm7	UTSW	5	138,167,387 (GRCm39)	missense	probably damaging	1.00
R4882:Mcm7	UTSW	5	138,164,173 (GRCm39)	splice site	probably null
R5012:Mcm7	UTSW	5	138,167,609 (GRCm39)	critical splice donor site	probably null
R5517:Mcm7	UTSW	5	138,163,133 (GRCm39)	missense	possibly damaging	0.92
R5718:Mcm7	UTSW	5	138,163,081 (GRCm39)	missense	possibly damaging	0.95
R7604:Mcm7	UTSW	5	138,167,986 (GRCm39)	missense	probably benign	0.01
R8806:Mcm7	UTSW	5	138,163,347 (GRCm39)	missense	possibly damaging	0.81
R9139:Mcm7	UTSW	5	138,167,397 (GRCm39)	missense	probably damaging	1.00
R9209:Mcm7	UTSW	5	138,166,593 (GRCm39)	critical splice donor site	probably null
R9421:Mcm7	UTSW	5	138,165,477 (GRCm39)	missense	possibly damaging	0.76
R9681:Mcm7	UTSW	5	138,164,220 (GRCm39)	nonsense	probably null
R9707:Mcm7	UTSW	5	138,170,000 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTCATTCACCGGAGGTCATTGTC -3'
(R):5'- TGCAGGTCAGTACACAACAGGC -3'

Sequencing Primer
(F):5'- CCGGAGGTCATTGTCTCTGTC -3'
(R):5'- TCCTCTGGTGTAGGGCTCAC -3'

Posted On

2014-02-18