Mutagenetix > Incidental Mutation

Incidental Mutation 'R1306:Pdzph1'

157813

Institutional Source

Beutler Lab

Gene Symbol

Pdzph1

Ensembl Gene

ENSMUSG00000024227

Gene Name

PDZ and pleckstrin homology domains 1

Synonyms

2610034M16Rik

MMRRC Submission

039372-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1306 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58878808-58991375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58932432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 967 (H967R)

Ref Sequence

ENSEMBL: ENSMUSP00000025064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025064]

AlphaFold

Q8BGR1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025064
AA Change: H967R

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: H967R

Domain	Start	End	E-Value	Type
Blast:PDZ	780	844	6e-20	BLAST
PDZ	915	984	3.31e-15	SMART
PH	993	1096	9.4e-19	SMART
PH	1120	1218	2.83e-13	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.9%
10x: 95.1%
20x: 89.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk3	T	A	7: 81,093,873	L1146H	probably damaging	Het
Atad2b	A	G	12: 4,974,239	I121M	probably benign	Het
Atg2a	A	T	19: 6,253,021	T1053S	probably benign	Het
Bend5	C	T	4: 111,459,773	Q127*	probably null	Het
Ccser1	G	A	6: 62,380,106	D843N	probably damaging	Het
Dennd4b	A	G	3: 90,271,165	T512A	probably benign	Het
Dnmbp	A	T	19: 43,901,779	D516E	probably benign	Het
Dok3	C	A	13: 55,527,448	E86*	probably null	Het
Fat3	A	G	9: 16,376,679	I516T	probably damaging	Het
Gabbr1	T	A	17: 37,055,990		probably null	Het
Gjd2	T	C	2: 114,011,865	T44A	probably damaging	Het
Mcm7	C	A	5: 138,167,203	A480S	probably damaging	Het
Meox2	GCACCACCACCACCACCACCA	GCACCACCACCACCACCA	12: 37,109,031		probably benign	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Pik3c2g	A	G	6: 139,772,428	N227S	probably benign	Het
Pkd1	T	C	17: 24,573,172	S1278P	probably damaging	Het
Plch2	T	C	4: 155,007,140	E71G	probably damaging	Het
Pnmal1	A	G	7: 16,962,025	R428G	probably benign	Het
Sertad2	T	C	11: 20,648,388	S195P	probably benign	Het
Slc19a3	A	G	1: 83,022,762	L178S	probably damaging	Het
Smarca2	A	G	19: 26,770,988	D139G	possibly damaging	Het
Tm4sf19	G	A	16: 32,407,902	V170M	probably damaging	Het
Vwa3a	C	G	7: 120,800,390	S1031R	possibly damaging	Het

Other mutations in Pdzph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Pdzph1	APN	17	58974796	missense	possibly damaging	0.46
IGL00644:Pdzph1	APN	17	58888110	missense	probably benign
IGL01413:Pdzph1	APN	17	58879152	missense	possibly damaging	0.82
IGL01530:Pdzph1	APN	17	58922715	missense	probably damaging	1.00
IGL02089:Pdzph1	APN	17	58967339	missense	possibly damaging	0.92
IGL02201:Pdzph1	APN	17	58967511	splice site	probably benign
IGL02548:Pdzph1	APN	17	58973391	missense	probably benign	0.10
IGL02618:Pdzph1	APN	17	58879073	utr 3 prime	probably benign
IGL02660:Pdzph1	APN	17	58880647	missense	probably damaging	0.97
IGL02749:Pdzph1	APN	17	58932483	missense	possibly damaging	0.95
IGL02876:Pdzph1	APN	17	58974069	missense	probably benign
IGL03304:Pdzph1	APN	17	58880646	missense	probably damaging	1.00
IGL03336:Pdzph1	APN	17	58974234	missense	probably benign	0.00
R0008:Pdzph1	UTSW	17	58922761	splice site	probably benign
R0008:Pdzph1	UTSW	17	58922761	splice site	probably benign
R0498:Pdzph1	UTSW	17	58973830	missense	probably benign	0.00
R0553:Pdzph1	UTSW	17	58922727	missense	probably damaging	1.00
R0594:Pdzph1	UTSW	17	58954479	missense	possibly damaging	0.76
R1370:Pdzph1	UTSW	17	58974087	missense	possibly damaging	0.73
R1382:Pdzph1	UTSW	17	58974747	missense	probably benign	0.10
R1463:Pdzph1	UTSW	17	58932445	missense	probably damaging	1.00
R1766:Pdzph1	UTSW	17	58973752	missense	probably benign	0.16
R1773:Pdzph1	UTSW	17	58974813	missense	probably damaging	0.98
R1862:Pdzph1	UTSW	17	58922583	missense	probably damaging	1.00
R2070:Pdzph1	UTSW	17	58974097	missense	probably benign	0.04
R2071:Pdzph1	UTSW	17	58974097	missense	probably benign	0.04
R2229:Pdzph1	UTSW	17	58932412	splice site	probably benign
R2264:Pdzph1	UTSW	17	58888167	critical splice acceptor site	probably null
R2334:Pdzph1	UTSW	17	58922649	missense	probably damaging	1.00
R3750:Pdzph1	UTSW	17	58973336	nonsense	probably null
R4700:Pdzph1	UTSW	17	58974546	missense	probably damaging	0.98
R4847:Pdzph1	UTSW	17	58973530	missense	possibly damaging	0.95
R4868:Pdzph1	UTSW	17	58974756	missense	probably benign	0.00
R5130:Pdzph1	UTSW	17	58922609	missense	probably damaging	1.00
R5329:Pdzph1	UTSW	17	58974880	missense	probably damaging	1.00
R5574:Pdzph1	UTSW	17	58973947	missense	probably benign	0.00
R5770:Pdzph1	UTSW	17	58879151	missense	probably damaging	1.00
R5795:Pdzph1	UTSW	17	58885867	missense	possibly damaging	0.47
R5842:Pdzph1	UTSW	17	58974412	missense	possibly damaging	0.64
R5851:Pdzph1	UTSW	17	58973746	missense	probably benign	0.02
R6158:Pdzph1	UTSW	17	58973627	missense	probably damaging	0.96
R6813:Pdzph1	UTSW	17	58974436	missense	probably benign	0.08
R7022:Pdzph1	UTSW	17	58974126	missense	probably benign	0.02
R7395:Pdzph1	UTSW	17	58879159	missense	possibly damaging	0.85
R7525:Pdzph1	UTSW	17	58967341	missense	possibly damaging	0.73
R7944:Pdzph1	UTSW	17	58932460	missense	probably damaging	1.00
R7945:Pdzph1	UTSW	17	58932460	missense	probably damaging	1.00
R7992:Pdzph1	UTSW	17	58879110	missense	possibly damaging	0.71
R8016:Pdzph1	UTSW	17	58932481	missense	probably damaging	0.98
R8116:Pdzph1	UTSW	17	58975143	missense	probably benign	0.01
R8273:Pdzph1	UTSW	17	58973014	missense	probably benign	0.00
R8523:Pdzph1	UTSW	17	58884013	missense	probably damaging	1.00
R8819:Pdzph1	UTSW	17	58880720	nonsense	probably null
R8820:Pdzph1	UTSW	17	58880720	nonsense	probably null
R8839:Pdzph1	UTSW	17	58950242	missense	probably benign	0.02
R8871:Pdzph1	UTSW	17	58888038	missense	probably damaging	1.00
R8898:Pdzph1	UTSW	17	58974339	missense	probably benign	0.00
R8959:Pdzph1	UTSW	17	58974604	missense	probably damaging	0.97
R9043:Pdzph1	UTSW	17	58973540	missense	probably benign	0.05
R9083:Pdzph1	UTSW	17	58954400	missense	possibly damaging	0.94
R9092:Pdzph1	UTSW	17	58973130	missense	probably damaging	1.00
R9682:Pdzph1	UTSW	17	58950267	missense	probably damaging	1.00
R9757:Pdzph1	UTSW	17	58974903	nonsense	probably null
R9774:Pdzph1	UTSW	17	58974756	missense	probably benign	0.00
X0028:Pdzph1	UTSW	17	58879121	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAATGCCTGGTGTAGACGTG -3'
(R):5'- GCCTCTCAAATGCCTGGCTGAATG -3'

Sequencing Primer
(F):5'- GTAGACGTGAGATTTAATCACTAGG -3'
(R):5'- ctctctctctctctctctctctc -3'

Posted On

2014-02-18