Incidental Mutation 'R1307:Polr3f'
ID157820
Institutional Source Beutler Lab
Gene Symbol Polr3f
Ensembl Gene ENSMUSG00000027427
Gene Namepolymerase (RNA) III (DNA directed) polypeptide F
Synonyms3110032A07Rik, 3010019O03Rik, RPC6, RPC39, 2810411G20Rik
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144527718-144541995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144533193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 95 (V95A)
Ref Sequence ENSEMBL: ENSMUSP00000105644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028914] [ENSMUST00000110017]
Predicted Effect probably damaging
Transcript: ENSMUST00000028914
AA Change: V95A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028914
Gene: ENSMUSG00000027427
AA Change: V95A

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 315 6.8e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110017
AA Change: V95A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105644
Gene: ENSMUSG00000027427
AA Change: V95A

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 105 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155567
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Polr3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Polr3f UTSW 2 144536275 unclassified probably benign
R0761:Polr3f UTSW 2 144534407 missense probably damaging 1.00
R1340:Polr3f UTSW 2 144538628 missense probably benign 0.01
R1992:Polr3f UTSW 2 144536310 missense probably benign 0.00
R4817:Polr3f UTSW 2 144534081 makesense probably null
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6291:Polr3f UTSW 2 144534388 missense probably damaging 1.00
R8214:Polr3f UTSW 2 144536310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAGAGGACCTGCTCTTGGTAAT -3'
(R):5'- GCATGTAACAGGATATGCCTGCAATCT -3'

Sequencing Primer
(F):5'- tttttccctttctttctcgctc -3'
(R):5'- GCCTGCAATCTCAAATATCAGGAAG -3'
Posted On2014-02-18