Incidental Mutation 'R1307:Kdm4a'
ID157823
Institutional Source Beutler Lab
Gene Symbol Kdm4a
Ensembl Gene ENSMUSG00000033326
Gene Namelysine (K)-specific demethylase 4A
SynonymsJmjd2, D4Ertd222e, JHDM3A, Jmjd2a
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118136957-118180043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118175642 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000062910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050288] [ENSMUST00000097911] [ENSMUST00000106403] [ENSMUST00000106406]
Predicted Effect probably benign
Transcript: ENSMUST00000050288
AA Change: T76A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000062910
Gene: ENSMUSG00000033326
AA Change: T76A

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097911
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095524
Gene: ENSMUSG00000033326
AA Change: T76A

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106403
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102011
Gene: ENSMUSG00000033326
AA Change: T76A

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106406
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102014
Gene: ENSMUSG00000033326
AA Change: T76A

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Kdm4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kdm4a APN 4 118160501 missense probably damaging 1.00
IGL01845:Kdm4a APN 4 118160459 missense possibly damaging 0.85
IGL02009:Kdm4a APN 4 118160169 missense probably benign 0.01
IGL02296:Kdm4a APN 4 118177465 missense probably damaging 1.00
IGL02366:Kdm4a APN 4 118160506 critical splice acceptor site probably null
IGL02606:Kdm4a APN 4 118160289 missense probably benign 0.00
IGL02673:Kdm4a APN 4 118168572 missense probably benign 0.00
R0245:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0326:Kdm4a UTSW 4 118161706 missense probably benign 0.00
R0551:Kdm4a UTSW 4 118138231 makesense probably null
R0603:Kdm4a UTSW 4 118142511 missense probably damaging 1.00
R0652:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0799:Kdm4a UTSW 4 118146992 splice site probably null
R0847:Kdm4a UTSW 4 118164498 missense probably damaging 0.96
R1572:Kdm4a UTSW 4 118138949 missense possibly damaging 0.89
R1869:Kdm4a UTSW 4 118138871 missense probably null 1.00
R1902:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R1903:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R2135:Kdm4a UTSW 4 118142459 missense probably damaging 1.00
R3856:Kdm4a UTSW 4 118153231 missense probably damaging 1.00
R4687:Kdm4a UTSW 4 118144083 missense probably damaging 1.00
R4940:Kdm4a UTSW 4 118161754 missense probably benign 0.00
R5115:Kdm4a UTSW 4 118162581 missense possibly damaging 0.75
R5229:Kdm4a UTSW 4 118146605 missense probably damaging 0.99
R5305:Kdm4a UTSW 4 118160501 missense probably damaging 1.00
R5423:Kdm4a UTSW 4 118138908 missense probably damaging 1.00
R5750:Kdm4a UTSW 4 118142199 intron probably benign
R5849:Kdm4a UTSW 4 118161840 missense probably benign 0.17
R5876:Kdm4a UTSW 4 118138876 missense probably damaging 0.98
R6564:Kdm4a UTSW 4 118177439 missense probably benign 0.18
R6772:Kdm4a UTSW 4 118142555 critical splice acceptor site probably null
R6982:Kdm4a UTSW 4 118153439 splice site probably null
R7410:Kdm4a UTSW 4 118143918 missense possibly damaging 0.64
R7418:Kdm4a UTSW 4 118160243 missense probably damaging 0.99
Z1176:Kdm4a UTSW 4 118153190 missense probably benign 0.00
Z1176:Kdm4a UTSW 4 118177502 missense probably benign 0.41
Z1177:Kdm4a UTSW 4 118147169 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTGGCTGAGCCTTAACTGCTGC -3'
(R):5'- TGTTCTCGTGACAGCGTGACTTCC -3'

Sequencing Primer
(F):5'- CTTAACTGCTGCGCTTGAAG -3'
(R):5'- TCTGGTAAAATGGACCGCTAGTC -3'
Posted On2014-02-18