Incidental Mutation 'R1307:Gk2'
ID157825
Institutional Source Beutler Lab
Gene Symbol Gk2
Ensembl Gene ENSMUSG00000050553
Gene Nameglycerol kinase 2
SynonymsGk-rs2
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location97455142-97457021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97455409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 523 (D523E)
Ref Sequence ENSEMBL: ENSMUSP00000052226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059657]
Predicted Effect probably benign
Transcript: ENSMUST00000059657
AA Change: D523E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052226
Gene: ENSMUSG00000050553
AA Change: D523E

DomainStartEndE-ValueType
Pfam:FGGY_N 12 266 2.3e-82 PFAM
Pfam:FGGY_C 275 467 5.8e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181724
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Gk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gk2 APN 5 97455787 missense probably damaging 1.00
R0967:Gk2 UTSW 5 97456296 missense probably benign
R2111:Gk2 UTSW 5 97456305 missense probably benign 0.00
R3939:Gk2 UTSW 5 97455352 missense possibly damaging 0.81
R4646:Gk2 UTSW 5 97456197 missense probably damaging 0.98
R4648:Gk2 UTSW 5 97455720 missense probably benign 0.04
R4718:Gk2 UTSW 5 97455866 missense probably benign 0.02
R6139:Gk2 UTSW 5 97456280 missense probably benign 0.03
R6792:Gk2 UTSW 5 97455729 missense probably benign 0.02
R7078:Gk2 UTSW 5 97456336 missense probably benign 0.00
R7088:Gk2 UTSW 5 97455675 missense probably damaging 0.97
R7388:Gk2 UTSW 5 97456898 missense probably damaging 1.00
R7699:Gk2 UTSW 5 97456398 missense probably benign
X0062:Gk2 UTSW 5 97456649 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGGTTCCTGTAAGCAAGTGGC -3'
(R):5'- ACAGGCAGATATTCTGCACATTCCG -3'

Sequencing Primer
(F):5'- ACATTGCAAGTCCGTGGT -3'
(R):5'- AGTCTGTCATGCCTGAAACG -3'
Posted On2014-02-18