Incidental Mutation 'R1307:Cabp1'
ID157826
Institutional Source Beutler Lab
Gene Symbol Cabp1
Ensembl Gene ENSMUSG00000029544
Gene Namecalcium binding protein 1
Synonyms
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115168689-115194381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115172906 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 294 (F294L)
Ref Sequence ENSEMBL: ENSMUSP00000107741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031519] [ENSMUST00000112112] [ENSMUST00000112113] [ENSMUST00000145197]
Predicted Effect probably damaging
Transcript: ENSMUST00000031519
AA Change: F171L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031519
Gene: ENSMUSG00000029544
AA Change: F171L

DomainStartEndE-ValueType
EFh 86 114 1.22e-5 SMART
Blast:EFh 122 150 1e-7 BLAST
EFh 163 191 3.93e-9 SMART
EFh 200 227 7.82e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112109
SMART Domains Protein: ENSMUSP00000107737
Gene: ENSMUSG00000029544

DomainStartEndE-ValueType
EFh 71 99 1.22e-5 SMART
Blast:EFh 107 135 8e-8 BLAST
EFh 148 176 3.93e-9 SMART
EFh 185 212 7.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112112
AA Change: F111L

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107740
Gene: ENSMUSG00000029544
AA Change: F111L

DomainStartEndE-ValueType
EFh 26 54 1.22e-5 SMART
Blast:EFh 62 90 5e-8 BLAST
EFh 103 131 3.93e-9 SMART
EFh 140 167 7.82e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112113
AA Change: F294L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107741
Gene: ENSMUSG00000029544
AA Change: F294L

DomainStartEndE-ValueType
low complexity region 29 55 N/A INTRINSIC
low complexity region 58 113 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
EFh 209 237 1.22e-5 SMART
Blast:EFh 245 273 3e-7 BLAST
EFh 286 314 3.93e-9 SMART
EFh 323 350 7.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151775
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and show no apparent motor deficits, but they are affected in the transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Cabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1280:Cabp1 UTSW 5 115175471 missense probably benign 0.06
R1435:Cabp1 UTSW 5 115173208 missense probably damaging 1.00
R2509:Cabp1 UTSW 5 115172784 missense probably damaging 1.00
R4417:Cabp1 UTSW 5 115186037 missense possibly damaging 0.68
R4788:Cabp1 UTSW 5 115175471 missense probably benign 0.06
R4837:Cabp1 UTSW 5 115173153 missense probably damaging 1.00
R5026:Cabp1 UTSW 5 115175472 missense possibly damaging 0.83
R5199:Cabp1 UTSW 5 115186043 missense possibly damaging 0.92
R6513:Cabp1 UTSW 5 115169134 missense possibly damaging 0.51
R6941:Cabp1 UTSW 5 115172901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCATGGATTGGCATATACACAG -3'
(R):5'- TGACCTCATTGACCTCGGTCACAC -3'

Sequencing Primer
(F):5'- CATGGATTGGCATATACACAGATACG -3'
(R):5'- GAGAGTGGCTCAATCCCTTC -3'
Posted On2014-02-18