Incidental Mutation 'R1307:Rhof'
ID157827
Institutional Source Beutler Lab
Gene Symbol Rhof
Ensembl Gene ENSMUSG00000029449
Gene Nameras homolog family member F (in filopodia)
SynonymsIfld1, Arhf
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1307 (G1)
Quality Score170
Status Not validated
Chromosome5
Chromosomal Location123103044-123132692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123120315 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 151 (E151G)
Ref Sequence ENSEMBL: ENSMUSP00000140177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031401] [ENSMUST00000067505] [ENSMUST00000111619] [ENSMUST00000160479] [ENSMUST00000186469]
Predicted Effect probably damaging
Transcript: ENSMUST00000031401
AA Change: E151G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031401
Gene: ENSMUSG00000029449
AA Change: E151G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067505
SMART Domains Protein: ENSMUSP00000068551
Gene: ENSMUSG00000054434

DomainStartEndE-ValueType
Pfam:TMPIT 9 332 1.9e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111619
SMART Domains Protein: ENSMUSP00000107246
Gene: ENSMUSG00000054434

DomainStartEndE-ValueType
Pfam:TMPIT 7 64 1.3e-14 PFAM
Pfam:TMPIT 60 298 1.3e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160479
AA Change: E151G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124866
Gene: ENSMUSG00000029449
AA Change: E151G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect probably damaging
Transcript: ENSMUST00000186469
AA Change: E151G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140177
Gene: ENSMUSG00000029449
AA Change: E151G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit macrothrombocytopenia without an effect on filopodia generation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Rhof
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0811:Rhof UTSW 5 123131887 missense probably damaging 0.99
R0812:Rhof UTSW 5 123131887 missense probably damaging 0.99
R3926:Rhof UTSW 5 123104530 critical splice acceptor site probably null
R4125:Rhof UTSW 5 123119525 missense probably damaging 1.00
R4708:Rhof UTSW 5 123120391 missense probably benign 0.21
R5299:Rhof UTSW 5 123120548 missense probably damaging 1.00
R6732:Rhof UTSW 5 123131936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACCATGCACAGTATTTAACCC -3'
(R):5'- GATGTCATGAACCCCACCAGTTACG -3'

Sequencing Primer
(F):5'- catgcacagTATTTAACCCTTGTTTG -3'
(R):5'- AACGTCCTCATCAAGGTACTGTC -3'
Posted On2014-02-18