Incidental Mutation 'R1307:Coq8b'
ID157828
Institutional Source Beutler Lab
Gene Symbol Coq8b
Ensembl Gene ENSMUSG00000003762
Gene Namecoenzyme Q8B
Synonyms0610012P18Rik, Adck4
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27233023-27257950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27250591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 365 (M365K)
Ref Sequence ENSEMBL: ENSMUSP00000104015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003860] [ENSMUST00000108378] [ENSMUST00000128090]
Predicted Effect probably damaging
Transcript: ENSMUST00000003860
AA Change: M365K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: M365K

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108378
AA Change: M365K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: M365K

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123012
Predicted Effect probably benign
Transcript: ENSMUST00000128090
SMART Domains Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 304 3.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152342
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Coq8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Coq8b APN 7 27257477 missense probably benign
IGL01116:Coq8b APN 7 27239857 missense possibly damaging 0.82
IGL01123:Coq8b APN 7 27240084 missense probably damaging 1.00
IGL02949:Coq8b APN 7 27256613 missense possibly damaging 0.70
R0067:Coq8b UTSW 7 27233481 missense possibly damaging 0.87
R0690:Coq8b UTSW 7 27242249 missense probably benign 0.15
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1551:Coq8b UTSW 7 27257482 missense probably damaging 1.00
R1682:Coq8b UTSW 7 27240124 missense probably benign 0.00
R1895:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R1945:Coq8b UTSW 7 27233980 small insertion probably benign
R1945:Coq8b UTSW 7 27233981 small insertion probably benign
R1946:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R2069:Coq8b UTSW 7 27257377 missense probably damaging 1.00
R3758:Coq8b UTSW 7 27242227 nonsense probably null
R4545:Coq8b UTSW 7 27233505 missense probably benign 0.45
R4838:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R5181:Coq8b UTSW 7 27252322 missense possibly damaging 0.65
R5345:Coq8b UTSW 7 27250348 missense probably benign
R5806:Coq8b UTSW 7 27250625 nonsense probably null
R5943:Coq8b UTSW 7 27234003 missense probably damaging 1.00
R6005:Coq8b UTSW 7 27257325 nonsense probably null
R7028:Coq8b UTSW 7 27239868 missense probably damaging 1.00
R7709:Coq8b UTSW 7 27250537 missense probably damaging 0.98
R8300:Coq8b UTSW 7 27242246 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GGGCCTGAGCCAAGACATCC -3'
(R):5'- TTTGTACTTTGGACCTACATGGCCTG -3'

Sequencing Primer
(F):5'- CCGGAATCAGGTACATCTCC -3'
(R):5'- agccatccctccagccc -3'
Posted On2014-02-18