Incidental Mutation 'R1307:Uba52'
ID157831
Institutional Source Beutler Lab
Gene Symbol Uba52
Ensembl Gene ENSMUSG00000090137
Gene Nameubiquitin A-52 residue ribosomal protein fusion product 1
SynonymsD8Ertd21e
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1307 (G1)
Quality Score223
Status Not validated
Chromosome8
Chromosomal Location70508263-70510801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70508516 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 68 (H68R)
Ref Sequence ENSEMBL: ENSMUSP00000122797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000081940] [ENSMUST00000093456] [ENSMUST00000121623] [ENSMUST00000124967] [ENSMUST00000125184] [ENSMUST00000129909] [ENSMUST00000135446] [ENSMUST00000136913] [ENSMUST00000140679] [ENSMUST00000165126] [ENSMUST00000138260]
PDB Structure
Crystal structure of GFP-Wrnip1 UBZ domain fusion protein in complex with ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000008032
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081940
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080608
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093456
SMART Domains Protein: ENSMUSP00000091165
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 1.9e-40 PFAM
low complexity region 115 124 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121623
AA Change: H172R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113804
Gene: ENSMUSG00000055553
AA Change: H172R

DomainStartEndE-ValueType
Pfam:KxDL 14 99 3.3e-34 PFAM
UBQ 105 176 2.14e-36 SMART
Ribosomal_L40e 181 232 1.02e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124967
AA Change: H68R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122797
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 96 5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125184
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120096
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127793
Predicted Effect probably benign
Transcript: ENSMUST00000127983
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128620
Predicted Effect probably damaging
Transcript: ENSMUST00000129909
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121149
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Ribosomal_L40e 77 128 1.02e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect probably damaging
Transcript: ENSMUST00000135446
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123562
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140679
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123263
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165126
AA Change: H68R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137461
Gene: ENSMUSG00000090137
AA Change: H68R

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138260
AA Change: H172R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553
AA Change: H172R

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Uba52
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0122:Uba52 UTSW 8 70509301 missense probably damaging 1.00
R1470:Uba52 UTSW 8 70509556 missense possibly damaging 0.90
R1470:Uba52 UTSW 8 70509556 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACACCAATTACTGCTCCAGTGGATG -3'
(R):5'- TTGACTTGTGCTCTCACCAGACTTG -3'

Sequencing Primer
(F):5'- GTCACATGCCAGGTATGACC -3'
(R):5'- CAGACTTGTAAAGTTCCCAGGTG -3'
Posted On2014-02-18