Incidental Mutation 'R1307:Bcl2a1b'
ID157834
Institutional Source Beutler Lab
Gene Symbol Bcl2a1b
Ensembl Gene ENSMUSG00000089929
Gene NameB cell leukemia/lymphoma 2 related protein A1b
SynonymsA1-b
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89199209-89207827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89199490 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000065612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068569]
Predicted Effect probably damaging
Transcript: ENSMUST00000068569
AA Change: V44A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065612
Gene: ENSMUSG00000089929
AA Change: V44A

DomainStartEndE-ValueType
BCL 37 140 5.55e-40 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138109
AA Change: V37A
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838
AA Change: V37A

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Bcl2a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0379:Bcl2a1b UTSW 9 89199736 missense possibly damaging 0.95
R2402:Bcl2a1b UTSW 9 89199742 missense probably benign 0.06
R4898:Bcl2a1b UTSW 9 89199660 nonsense probably null
R5098:Bcl2a1b UTSW 9 89199379 missense probably benign 0.00
R5710:Bcl2a1b UTSW 9 89199679 missense probably benign 0.01
R6594:Bcl2a1b UTSW 9 89207594 missense probably benign
R7059:Bcl2a1b UTSW 9 89199760 missense probably damaging 1.00
W0251:Bcl2a1b UTSW 9 89199583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGCTGTGACATGATGCAAAC -3'
(R):5'- GTAAGCACCTACATCCAGGGCAATC -3'

Sequencing Primer
(F):5'- GCCTCCAGATATGATTAGGGTTCC -3'
(R):5'- CAATCTGCTCTTGCGGAAG -3'
Posted On2014-02-18