Incidental Mutation 'R1307:Ascc1'
ID157836
Institutional Source Beutler Lab
Gene Symbol Ascc1
Ensembl Gene ENSMUSG00000044475
Gene Nameactivating signal cointegrator 1 complex subunit 1
Synonyms1810015P09Rik, ASC1p50, CGI-18
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location60002805-60099988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60012499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 83 (I83L)
Ref Sequence ENSEMBL: ENSMUSP00000126301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050516] [ENSMUST00000164083]
Predicted Effect probably benign
Transcript: ENSMUST00000050516
AA Change: I83L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052351
Gene: ENSMUSG00000044475
AA Change: I83L

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 4.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164083
AA Change: I83L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126301
Gene: ENSMUSG00000044475
AA Change: I83L

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 3e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219778
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Ascc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ascc1 APN 10 60012458 splice site probably benign
Dagger UTSW 10 60013653 missense probably damaging 1.00
stiletto UTSW 10 60004819 start codon destroyed probably damaging 1.00
R1463:Ascc1 UTSW 10 60062516 missense probably benign 0.17
R2403:Ascc1 UTSW 10 60004841 missense probably benign 0.20
R4308:Ascc1 UTSW 10 60013612 missense probably benign 0.00
R4703:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4704:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4705:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4916:Ascc1 UTSW 10 60004862 missense probably benign 0.01
R6906:Ascc1 UTSW 10 60004852 missense probably benign 0.01
R6944:Ascc1 UTSW 10 60013653 missense probably damaging 1.00
R7227:Ascc1 UTSW 10 60007738 missense probably benign 0.08
R7661:Ascc1 UTSW 10 60049807 missense probably damaging 1.00
R7766:Ascc1 UTSW 10 60004819 start codon destroyed probably damaging 1.00
R7940:Ascc1 UTSW 10 60012559 missense probably null 1.00
R8104:Ascc1 UTSW 10 60007729 missense probably benign
Z1176:Ascc1 UTSW 10 60007793 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GAGTGAAGATAGCATGTCCCATGAGTC -3'
(R):5'- TGCATGGATGCACAGATGCACG -3'

Sequencing Primer
(F):5'- AGCATGTCCCATGAGTCCTAATTAC -3'
(R):5'- acacacacacacacaatctaaac -3'
Posted On2014-02-18