Incidental Mutation 'R1307:Sphk1'
ID157839
Institutional Source Beutler Lab
Gene Symbol Sphk1
Ensembl Gene ENSMUSG00000061878
Gene Namesphingosine kinase 1
Synonyms1110006G24Rik, SK1
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1307 (G1)
Quality Score209
Status Not validated
Chromosome11
Chromosomal Location116530925-116536674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116536102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 295 (V295I)
Ref Sequence ENSEMBL: ENSMUSP00000131010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000141798] [ENSMUST00000155102] [ENSMUST00000138840] [ENSMUST00000145737] [ENSMUST00000154034]
Predicted Effect probably benign
Transcript: ENSMUST00000063396
AA Change: V289I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878
AA Change: V289I

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063446
AA Change: V289I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878
AA Change: V289I

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082152
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100201
AA Change: V288I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878
AA Change: V288I

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106386
AA Change: V289I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878
AA Change: V289I

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106387
AA Change: V289I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878
AA Change: V289I

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106388
AA Change: V289I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878
AA Change: V289I

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136526
Predicted Effect probably benign
Transcript: ENSMUST00000141798
AA Change: V295I

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878
AA Change: V295I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148185
Predicted Effect probably benign
Transcript: ENSMUST00000155102
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138840
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145737
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154034
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are viable, fertile, and without any obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Slc25a28 T C 19: 43,667,031 N135S probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Sphk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0040:Sphk1 UTSW 11 116535065 splice site probably benign
R0565:Sphk1 UTSW 11 116536358 unclassified probably benign
R1635:Sphk1 UTSW 11 116535770 missense probably damaging 1.00
R1940:Sphk1 UTSW 11 116535850 missense probably benign 0.00
R4685:Sphk1 UTSW 11 116535280 missense probably damaging 1.00
R5440:Sphk1 UTSW 11 116534888 missense possibly damaging 0.54
R5621:Sphk1 UTSW 11 116536366 unclassified probably benign
R6767:Sphk1 UTSW 11 116536156 missense possibly damaging 0.93
R7150:Sphk1 UTSW 11 116535081 missense probably benign 0.07
R7207:Sphk1 UTSW 11 116535764 missense probably damaging 1.00
R7758:Sphk1 UTSW 11 116536237 missense possibly damaging 0.75
R8084:Sphk1 UTSW 11 116535078 critical splice acceptor site probably null
RF018:Sphk1 UTSW 11 116534945 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAGATTCGTTTCACAGTGGGCACC -3'
(R):5'- TTGGCCCTGCACAGCTTCACATAC -3'

Sequencing Primer
(F):5'- GAACTGTGGCCTCTAAGAGACC -3'
(R):5'- AGCTTCACATACCATCAGCTCTC -3'
Posted On2014-02-18