Incidental Mutation 'R1308:G6pc2'
ID157847
Institutional Source Beutler Lab
Gene Symbol G6pc2
Ensembl Gene ENSMUSG00000005232
Gene Nameglucose-6-phosphatase, catalytic, 2
SynonymsIGRP, G6pc-rs, islet specific glucose-6-phosphatase
MMRRC Submission 039374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1308 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69211073-69227841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69220226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 65 (D65V)
Ref Sequence ENSEMBL: ENSMUSP00000107936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005364] [ENSMUST00000112317]
Predicted Effect probably damaging
Transcript: ENSMUST00000005364
AA Change: D65V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005364
Gene: ENSMUSG00000005232
AA Change: D65V

DomainStartEndE-ValueType
acidPPc 53 194 7.83e-21 SMART
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 254 273 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112317
AA Change: D65V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107936
Gene: ENSMUSG00000005232
AA Change: D65V

DomainStartEndE-ValueType
SCOP:d1d2ta_ 6 126 5e-13 SMART
Blast:acidPPc 53 147 1e-65 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151953
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a disruption of this gene show a significant drop in fasting blood glucose. Females also show a significant drop in plasma triacylglycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Jph1 A G 1: 17,091,694 I248T probably damaging Het
Lamc2 A G 1: 153,150,818 L230P probably damaging Het
Lmnb1 A G 18: 56,728,475 K146R probably benign Het
Map3k6 T C 4: 133,245,815 S395P probably damaging Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Pros1 G A 16: 62,913,865 D345N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
R3hdml G T 2: 163,502,399 C236F probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt12 A T 19: 4,460,735 V37E probably damaging Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdr27 T C 17: 14,928,384 T116A probably damaging Het
Other mutations in G6pc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:G6pc2 APN 2 69222967 missense probably damaging 1.00
IGL02031:G6pc2 APN 2 69222991 missense probably benign 0.36
IGL02504:G6pc2 APN 2 69226595 missense probably damaging 0.99
IGL02674:G6pc2 APN 2 69226566 critical splice acceptor site probably null
IGL03339:G6pc2 APN 2 69220895 splice site probably benign
R0011:G6pc2 UTSW 2 69226565 splice site probably benign
R1113:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1417:G6pc2 UTSW 2 69222968 missense probably damaging 1.00
R1441:G6pc2 UTSW 2 69220854 missense probably damaging 0.97
R1658:G6pc2 UTSW 2 69227069 missense probably damaging 1.00
R1762:G6pc2 UTSW 2 69220842 missense possibly damaging 0.53
R1768:G6pc2 UTSW 2 69222977 missense probably damaging 1.00
R3161:G6pc2 UTSW 2 69220112 missense probably damaging 0.98
R5487:G6pc2 UTSW 2 69226577 missense probably damaging 0.99
R5623:G6pc2 UTSW 2 69226583 missense probably damaging 1.00
R5686:G6pc2 UTSW 2 69220784 missense probably benign 0.03
R7493:G6pc2 UTSW 2 69223000 missense probably benign 0.00
R7733:G6pc2 UTSW 2 69220183 nonsense probably null
X0040:G6pc2 UTSW 2 69223010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGTAATGGCTCAGTGCATCACAAGG -3'
(R):5'- TGTCTCCCATAACCAGGGAAGTCC -3'

Sequencing Primer
(F):5'- TGCTTAGACCTGCATCAAGATGG -3'
(R):5'- CCAGGGAAGTCCTGTGGATG -3'
Posted On2014-02-18