Incidental Mutation 'R1308:Map3k6'
ID 157851
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Name mitogen-activated protein kinase kinase kinase 6
Synonyms Ask2, MAPKKK6, MEKK6
MMRRC Submission 039374-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.312) question?
Stock # R1308 (G1)
Quality Score 122
Status Not validated
Chromosome 4
Chromosomal Location 133240818-133252929 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133245815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 395 (S395P)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030677]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030677
AA Change: S395P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: S395P

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127681
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
G6pc2 A T 2: 69,220,226 D65V probably damaging Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Jph1 A G 1: 17,091,694 I248T probably damaging Het
Lamc2 A G 1: 153,150,818 L230P probably damaging Het
Lmnb1 A G 18: 56,728,475 K146R probably benign Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Pros1 G A 16: 62,913,865 D345N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
R3hdml G T 2: 163,502,399 C236F probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt12 A T 19: 4,460,735 V37E probably damaging Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdr27 T C 17: 14,928,384 T116A probably damaging Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0417:Map3k6 UTSW 4 133248082 nonsense probably null
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1607:Map3k6 UTSW 4 133252473 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 133246333 missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
R7069:Map3k6 UTSW 4 133251712 missense probably benign 0.01
R7216:Map3k6 UTSW 4 133246900 missense probably damaging 0.99
R7417:Map3k6 UTSW 4 133248396 missense probably benign 0.43
R7538:Map3k6 UTSW 4 133251927 missense probably benign
R7569:Map3k6 UTSW 4 133250077 missense probably benign 0.04
R8003:Map3k6 UTSW 4 133248882 missense probably benign 0.05
R8407:Map3k6 UTSW 4 133247593 missense possibly damaging 0.95
R8817:Map3k6 UTSW 4 133246760 missense probably benign 0.00
R8939:Map3k6 UTSW 4 133252643 unclassified probably benign
R9285:Map3k6 UTSW 4 133245559 missense probably damaging 1.00
R9308:Map3k6 UTSW 4 133243411 missense probably damaging 1.00
R9400:Map3k6 UTSW 4 133241156 missense probably damaging 1.00
R9401:Map3k6 UTSW 4 133241156 missense probably damaging 1.00
R9573:Map3k6 UTSW 4 133252463 missense probably damaging 0.99
R9677:Map3k6 UTSW 4 133241116 missense probably benign 0.04
R9682:Map3k6 UTSW 4 133248108 missense possibly damaging 0.61
R9745:Map3k6 UTSW 4 133252472 missense probably damaging 1.00
R9751:Map3k6 UTSW 4 133251857 critical splice acceptor site probably null
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGTATGAAGGTCCCGTGGCTC -3'
(R):5'- CTCAGGCACCGATCAGTATCGAAG -3'

Sequencing Primer
(F):5'- ACTTCTGGCTTCCAAAATGC -3'
(R):5'- AGTATCGAAGCCCACTTTGAGTC -3'
Posted On 2014-02-18