Incidental Mutation 'R1308:Havcr1'
ID157861
Institutional Source Beutler Lab
Gene Symbol Havcr1
Ensembl Gene ENSMUSG00000040405
Gene Namehepatitis A virus cellular receptor 1
SynonymsKIM-1, Tim1, TIM-1
MMRRC Submission 039374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1308 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46735080-46779578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46756270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 177 (T177I)
Ref Sequence ENSEMBL: ENSMUSP00000043827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047568] [ENSMUST00000081819] [ENSMUST00000109223] [ENSMUST00000109224]
Predicted Effect probably damaging
Transcript: ENSMUST00000047568
AA Change: T177I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043827
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081819
AA Change: T177I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080503
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109223
AA Change: T177I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104846
Gene: ENSMUSG00000040405
AA Change: T177I

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109224
SMART Domains Protein: ENSMUSP00000104847
Gene: ENSMUSG00000040405

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to S. mansoni egg challenge. Mice homozygous for an allele lacking the mucin domain display impaired regulatory B cell function and systemic autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
G6pc2 A T 2: 69,220,226 D65V probably damaging Het
Jph1 A G 1: 17,091,694 I248T probably damaging Het
Lamc2 A G 1: 153,150,818 L230P probably damaging Het
Lmnb1 A G 18: 56,728,475 K146R probably benign Het
Map3k6 T C 4: 133,245,815 S395P probably damaging Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Pros1 G A 16: 62,913,865 D345N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
R3hdml G T 2: 163,502,399 C236F probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt12 A T 19: 4,460,735 V37E probably damaging Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdr27 T C 17: 14,928,384 T116A probably damaging Het
Other mutations in Havcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Havcr1 APN 11 46775493 missense probably damaging 1.00
IGL02207:Havcr1 APN 11 46778576 missense probably benign 0.28
R0355:Havcr1 UTSW 11 46756224 missense possibly damaging 0.91
R0371:Havcr1 UTSW 11 46752589 missense possibly damaging 0.95
R0488:Havcr1 UTSW 11 46752571 missense probably damaging 1.00
R0883:Havcr1 UTSW 11 46752432 missense probably damaging 1.00
R1307:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1554:Havcr1 UTSW 11 46752507 missense probably benign
R1908:Havcr1 UTSW 11 46773684 nonsense probably null
R2165:Havcr1 UTSW 11 46778552 missense probably benign 0.14
R3085:Havcr1 UTSW 11 46756225 missense probably damaging 0.99
R3757:Havcr1 UTSW 11 46752580 missense probably damaging 1.00
R4719:Havcr1 UTSW 11 46752441 missense probably benign 0.02
R5191:Havcr1 UTSW 11 46756197 missense probably benign 0.40
R5440:Havcr1 UTSW 11 46752370 missense probably damaging 1.00
R5710:Havcr1 UTSW 11 46752526 missense probably damaging 1.00
R5988:Havcr1 UTSW 11 46756137 missense probably damaging 1.00
R7570:Havcr1 UTSW 11 46770542 critical splice donor site probably null
R7962:Havcr1 UTSW 11 46752575 nonsense probably null
Z1177:Havcr1 UTSW 11 46775498 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTCGAAGCTCTTGTCACTTCTTGC -3'
(R):5'- AGTGGCCCTGGTTCTCAGTCATTC -3'

Sequencing Primer
(F):5'- TGCCTGACTCATCCTTGC -3'
(R):5'- TTCATCAGAGAGTCATGCCCAG -3'
Posted On2014-02-18