Incidental Mutation 'R1308:Syt12'
ID157867
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Namesynaptotagmin XII
Synonyms
MMRRC Submission 039374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1308 (G1)
Quality Score103
Status Not validated
Chromosome19
Chromosomal Location4445908-4477447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4460735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 37 (V37E)
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295] [ENSMUST00000166191]
Predicted Effect probably damaging
Transcript: ENSMUST00000059295
AA Change: V37E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303
AA Change: V37E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166191
AA Change: V37E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130418
Gene: ENSMUSG00000049303
AA Change: V37E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
G6pc2 A T 2: 69,220,226 D65V probably damaging Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Jph1 A G 1: 17,091,694 I248T probably damaging Het
Lamc2 A G 1: 153,150,818 L230P probably damaging Het
Lmnb1 A G 18: 56,728,475 K146R probably benign Het
Map3k6 T C 4: 133,245,815 S395P probably damaging Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Pros1 G A 16: 62,913,865 D345N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
R3hdml G T 2: 163,502,399 C236F probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdr27 T C 17: 14,928,384 T116A probably damaging Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R4192:Syt12 UTSW 19 4447681 utr 3 prime probably benign
R5646:Syt12 UTSW 19 4456541 missense possibly damaging 0.54
R5769:Syt12 UTSW 19 4451044 missense probably damaging 1.00
R5785:Syt12 UTSW 19 4450994 missense possibly damaging 0.95
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 intron probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
R8042:Syt12 UTSW 19 4453824 missense probably damaging 0.98
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTTACTCAAGAAGCACAGGGCGA -3'
(R):5'- GCCAAGCACACAGGACACGTAAATAT -3'

Sequencing Primer
(F):5'- CCATTCACAGGGCGATATTAATC -3'
(R):5'- GCACACAGGACACGTAAATATATAAG -3'
Posted On2014-02-18