Mutagenetix > Incidental Mutation

Incidental Mutation 'R1309:Ankar'

157868

Institutional Source

Beutler Lab

Gene Symbol

Ankar

Ensembl Gene

ENSMUSG00000039342

Gene Name

ankyrin and armadillo repeat containing

Synonyms

4932422E22Rik

MMRRC Submission

039375-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R1309 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72642980-72700579 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72674004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 709 (I709V)

Ref Sequence

ENSEMBL: ENSMUSP00000054056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]

AlphaFold

A2RT91

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053499
AA Change: I709V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: I709V

Domain	Start	End	E-Value	Type
low complexity region	46	51	N/A	INTRINSIC
low complexity region	484	496	N/A	INTRINSIC
ANK	532	561	1.25e2	SMART
ANK	582	611	3.49e0	SMART
ANK	615	644	4.44e2	SMART
ANK	651	680	3.8e-1	SMART
ANK	684	714	9.87e0	SMART
ARM	744	784	5.96e-3	SMART
ARM	785	825	4.09e0	SMART
Blast:ARM	827	865	1e-15	BLAST
ARM	867	907	8.34e0	SMART
ARM	909	949	8.34e0	SMART
Blast:ARM	951	991	2e-13	BLAST
ARM	1034	1077	4.82e1	SMART
ARM	1084	1123	1.3e1	SMART
ARM	1257	1297	6.01e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211837
AA Change: I708V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000212573
AA Change: I491V

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Angptl2	G	A	2: 33,246,128	A442T	probably benign	Het
Asb2	A	G	12: 103,325,408	V372A	probably benign	Het
Ccm2l	A	T	2: 153,070,924	I129F	probably damaging	Het
Cdkal1	T	A	13: 29,357,583	I433F	possibly damaging	Het
Cpsf7	T	C	19: 10,533,467		probably null	Het
Dhx37	C	T	5: 125,417,438	W944*	probably null	Het
Dip2a	A	G	10: 76,279,776	L939P	probably damaging	Het
Kera	A	G	10: 97,609,426	T216A	possibly damaging	Het
Lmnb1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	18: 56,739,904		probably null	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Prep	A	G	10: 45,126,026	T426A	probably benign	Het
Rxfp1	C	T	3: 79,663,292		probably null	Het
Spag6	A	G	2: 18,734,216	Y319C	probably damaging	Het
Stk24	A	G	14: 121,302,786	Y134H	probably damaging	Het
Tdrd6	T	C	17: 43,626,621	I1179V	probably benign	Het
Tedc1	A	G	12: 113,161,780	E274G	probably benign	Het
Zswim2	A	T	2: 83,938,756	F87Y	probably damaging	Het

Other mutations in Ankar

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Ankar	APN	1	72690131	missense	probably damaging	1.00
IGL01013:Ankar	APN	1	72650989	missense	possibly damaging	0.90
IGL01135:Ankar	APN	1	72665219	missense	probably benign	0.28
IGL01824:Ankar	APN	1	72651727	missense	probably benign	0.40
IGL01885:Ankar	APN	1	72658703	missense	probably damaging	1.00
IGL01932:Ankar	APN	1	72698987	missense	probably benign	0.25
IGL02143:Ankar	APN	1	72658649	critical splice donor site	probably null
IGL02326:Ankar	APN	1	72666355	missense	probably damaging	1.00
IGL02445:Ankar	APN	1	72666365	missense	probably benign	0.05
IGL02606:Ankar	APN	1	72690285	missense	possibly damaging	0.61
IGL02635:Ankar	APN	1	72652431	missense	possibly damaging	0.93
IGL02680:Ankar	APN	1	72670116	missense	probably damaging	1.00
IGL02704:Ankar	APN	1	72652343	missense	possibly damaging	0.88
IGL03086:Ankar	APN	1	72643278	missense	possibly damaging	0.84
IGL03269:Ankar	APN	1	72665201	missense	probably damaging	0.99
IGL03368:Ankar	APN	1	72675813	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0488:Ankar	UTSW	1	72658732	missense	probably damaging	1.00
R0650:Ankar	UTSW	1	72656221	splice site	probably benign
R1121:Ankar	UTSW	1	72651663	splice site	probably null
R1163:Ankar	UTSW	1	72688705	missense	possibly damaging	0.82
R1300:Ankar	UTSW	1	72643164	missense	probably benign	0.00
R1366:Ankar	UTSW	1	72698649	missense	probably damaging	1.00
R1456:Ankar	UTSW	1	72665118	missense	probably benign	0.34
R1495:Ankar	UTSW	1	72643291	missense	probably benign
R1583:Ankar	UTSW	1	72679555	splice site	probably benign
R1635:Ankar	UTSW	1	72650138	missense	probably damaging	0.99
R1975:Ankar	UTSW	1	72658441	missense	possibly damaging	0.95
R2036:Ankar	UTSW	1	72666530	nonsense	probably null
R2511:Ankar	UTSW	1	72658694	missense	probably damaging	1.00
R2965:Ankar	UTSW	1	72675820	missense	probably benign	0.00
R3404:Ankar	UTSW	1	72643093	nonsense	probably null
R3417:Ankar	UTSW	1	72658976	critical splice donor site	probably null
R4072:Ankar	UTSW	1	72688592	missense	probably damaging	1.00
R4231:Ankar	UTSW	1	72658542	missense	probably benign	0.23
R4447:Ankar	UTSW	1	72687789	missense	possibly damaging	0.60
R4632:Ankar	UTSW	1	72647184	missense	probably benign	0.01
R4720:Ankar	UTSW	1	72699011	missense	possibly damaging	0.55
R4754:Ankar	UTSW	1	72698694	missense	probably damaging	1.00
R4884:Ankar	UTSW	1	72698807	missense	probably damaging	0.97
R5068:Ankar	UTSW	1	72680210	splice site	probably null
R5069:Ankar	UTSW	1	72680210	splice site	probably null
R5070:Ankar	UTSW	1	72680210	splice site	probably null
R5189:Ankar	UTSW	1	72658414	missense	probably benign	0.01
R5247:Ankar	UTSW	1	72680184	missense	probably benign	0.08
R5322:Ankar	UTSW	1	72690386	splice site	probably null
R5345:Ankar	UTSW	1	72670151	missense	possibly damaging	0.94
R5864:Ankar	UTSW	1	72659165	missense	probably benign	0.00
R5976:Ankar	UTSW	1	72643291	missense	probably benign
R6003:Ankar	UTSW	1	72698887	missense	probably damaging	1.00
R6042:Ankar	UTSW	1	72674054	nonsense	probably null
R6296:Ankar	UTSW	1	72643258	missense	probably damaging	1.00
R6488:Ankar	UTSW	1	72681808	critical splice donor site	probably null
R6885:Ankar	UTSW	1	72643036	missense	unknown
R6985:Ankar	UTSW	1	72658482	missense	probably damaging	1.00
R7060:Ankar	UTSW	1	72656113	missense	probably benign	0.18
R7099:Ankar	UTSW	1	72643293	missense	probably damaging	0.99
R7194:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7221:Ankar	UTSW	1	72650231	missense	probably damaging	1.00
R7222:Ankar	UTSW	1	72666355	missense	probably damaging	0.99
R7258:Ankar	UTSW	1	72651727	missense	probably benign	0.40
R7303:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7308:Ankar	UTSW	1	72651794	nonsense	probably null
R7384:Ankar	UTSW	1	72658465	missense	probably benign	0.00
R7424:Ankar	UTSW	1	72680058	missense	probably damaging	1.00
R7464:Ankar	UTSW	1	72698894	missense	possibly damaging	0.94
R7525:Ankar	UTSW	1	72688641	missense	probably benign	0.18
R7618:Ankar	UTSW	1	72675766	missense	probably benign	0.22
R7659:Ankar	UTSW	1	72690135	missense	possibly damaging	0.95
R7974:Ankar	UTSW	1	72698979	nonsense	probably null
R8008:Ankar	UTSW	1	72666484	missense	possibly damaging	0.47
R8119:Ankar	UTSW	1	72647001	missense	probably damaging	0.98
R8244:Ankar	UTSW	1	72651024	missense	probably benign
R8342:Ankar	UTSW	1	72652460	missense	probably damaging	1.00
R8494:Ankar	UTSW	1	72658794	missense	probably benign	0.16
R8851:Ankar	UTSW	1	72652376	missense	probably damaging	1.00
R8970:Ankar	UTSW	1	72652337	critical splice donor site	probably null
R9228:Ankar	UTSW	1	72674051	missense	probably benign	0.27
R9511:Ankar	UTSW	1	72680002	missense	probably benign	0.23
R9577:Ankar	UTSW	1	72681908	missense	probably benign	0.02
R9612:Ankar	UTSW	1	72665135	missense	possibly damaging	0.65
R9647:Ankar	UTSW	1	72650148	missense	probably damaging	1.00
R9803:Ankar	UTSW	1	72659181	missense	possibly damaging	0.47
Z1176:Ankar	UTSW	1	72689961	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGGGAGGAGCACATTTTGACATGTA -3'
(R):5'- CCACTTCGGGAGCCCTAGACACTA -3'

Sequencing Primer
(F):5'- CTGCCTTCTAAGAATGTTGGGAAAC -3'
(R):5'- GGGAGCCCTAGACACTATTCAG -3'

Posted On

2014-02-18