Incidental Mutation 'R1309:Angptl2'
ID157870
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R1309 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33246128 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 442 (A442T)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably benign
Transcript: ENSMUST00000004208
AA Change: A442T

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: A442T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCCACTTCCATTTTCACCTGAG -3'
(R):5'- TGACAGAGCCACATTGGAAAGCAC -3'

Sequencing Primer
(F):5'- gctgcctatctgtaatctaccatc -3'
(R):5'- TTGGAAAGCACAGTCCTCC -3'
Posted On2014-02-18