Mutagenetix > Incidental Mutations

Incidental Mutation 'R1309:Angptl2'

157870

Institutional Source

Beutler Lab

Gene Symbol

Angptl2

Ensembl Gene

ENSMUSG00000004105

Gene Name

angiopoietin-like 2

Synonyms

Arp2

MMRRC Submission

039375-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.306) question?

Stock #

R1309 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33216069-33247717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33246128 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 442 (A442T)

Ref Sequence

ENSEMBL: ENSMUSP00000004208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]

Predicted Effect

probably benign
Transcript: ENSMUST00000004208
AA Change: A442T

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: A442T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
coiled coil region	77	113	N/A	INTRINSIC
coiled coil region	152	180	N/A	INTRINSIC
low complexity region	205	228	N/A	INTRINSIC
FBG	273	488	3.62e-107	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000042615

SMART Domains

Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

Domain	Start	End	E-Value	Type
low complexity region	21	26	N/A	INTRINSIC
RasGEF	46	273	4.59e-86	SMART
low complexity region	286	301	N/A	INTRINSIC
PH	372	485	1.87e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091039

SMART Domains

Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

Domain	Start	End	E-Value	Type
low complexity region	21	26	N/A	INTRINSIC
RasGEF	46	290	7.54e-105	SMART
low complexity region	303	318	N/A	INTRINSIC
low complexity region	397	411	N/A	INTRINSIC
PH	460	573	1.87e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113165

SMART Domains

Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

Domain	Start	End	E-Value	Type
low complexity region	21	26	N/A	INTRINSIC
RasGEF	46	290	7.54e-105	SMART
low complexity region	303	318	N/A	INTRINSIC
low complexity region	397	411	N/A	INTRINSIC
PH	459	572	1.87e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131298

SMART Domains

Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

Domain	Start	End	E-Value	Type
low complexity region	21	26	N/A	INTRINSIC
RasGEF	46	290	7.54e-105	SMART
low complexity region	303	318	N/A	INTRINSIC
PH	390	503	1.87e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143252

Predicted Effect

probably benign
Transcript: ENSMUST00000193373

SMART Domains

Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Fibrinogen_C	49	112	4.2e-21	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankar	T	C	1: 72,674,004	I709V	possibly damaging	Het
Asb2	A	G	12: 103,325,408	V372A	probably benign	Het
Ccm2l	A	T	2: 153,070,924	I129F	probably damaging	Het
Cdkal1	T	A	13: 29,357,583	I433F	possibly damaging	Het
Cpsf7	T	C	19: 10,533,467		probably null	Het
Dhx37	C	T	5: 125,417,438	W944*	probably null	Het
Dip2a	A	G	10: 76,279,776	L939P	probably damaging	Het
Kera	A	G	10: 97,609,426	T216A	possibly damaging	Het
Lmnb1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	18: 56,739,904		probably null	Het
Olfr1368	C	T	13: 21,142,167	V297I	probably benign	Het
Prep	A	G	10: 45,126,026	T426A	probably benign	Het
Rxfp1	C	T	3: 79,663,292		probably null	Het
Spag6	A	G	2: 18,734,216	Y319C	probably damaging	Het
Stk24	A	G	14: 121,302,786	Y134H	probably damaging	Het
Tdrd6	T	C	17: 43,626,621	I1179V	probably benign	Het
Tedc1	A	G	12: 113,161,780	E274G	probably benign	Het
Zswim2	A	T	2: 83,938,756	F87Y	probably damaging	Het

Other mutations in Angptl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Angptl2	APN	2	33228394	missense	probably damaging	1.00
IGL00585:Angptl2	APN	2	33246227	missense	probably damaging	0.98
IGL00900:Angptl2	APN	2	33243772	missense	probably benign	0.00
IGL01521:Angptl2	APN	2	33246203	missense	probably damaging	1.00
IGL02711:Angptl2	APN	2	33228243	missense	probably benign	0.00
IGL02826:Angptl2	APN	2	33228315	missense	probably benign	0.19
R1541:Angptl2	UTSW	2	33246165	missense	probably benign	0.26
R1542:Angptl2	UTSW	2	33228885	missense	probably benign	0.24
R1604:Angptl2	UTSW	2	33243773	missense	possibly damaging	0.89
R3432:Angptl2	UTSW	2	33228802	missense	probably benign	0.02
R4331:Angptl2	UTSW	2	33228748	missense	probably damaging	0.99
R4652:Angptl2	UTSW	2	33243883	missense	probably damaging	1.00
R4741:Angptl2	UTSW	2	33246188	missense	probably benign	0.12
R5107:Angptl2	UTSW	2	33228603	missense	probably damaging	0.98
R5504:Angptl2	UTSW	2	33229038	intron	probably benign
R5694:Angptl2	UTSW	2	33228616	missense	probably damaging	1.00
R5967:Angptl2	UTSW	2	33228706	missense	probably damaging	1.00
R6185:Angptl2	UTSW	2	33229014	missense	probably benign	0.00
R6797:Angptl2	UTSW	2	33228265	missense	probably benign	0.00
R7151:Angptl2	UTSW	2	33243910	nonsense	probably null
R7471:Angptl2	UTSW	2	33243739	missense	possibly damaging	0.89
R7742:Angptl2	UTSW	2	33243916	missense	probably damaging	1.00
R7763:Angptl2	UTSW	2	33242382	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCCACTTCCATTTTCACCTGAG -3'
(R):5'- TGACAGAGCCACATTGGAAAGCAC -3'

Sequencing Primer
(F):5'- gctgcctatctgtaatctaccatc -3'
(R):5'- TTGGAAAGCACAGTCCTCC -3'

Posted On

2014-02-18