Incidental Mutation 'R1309:Ccm2l'
ID157872
Institutional Source Beutler Lab
Gene Symbol Ccm2l
Ensembl Gene ENSMUSG00000027474
Gene Namecerebral cavernous malformation 2-like
Synonyms
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1309 (G1)
Quality Score146
Status Not validated
Chromosome2
Chromosomal Location153065955-153081735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153070924 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 129 (I129F)
Ref Sequence ENSEMBL: ENSMUSP00000105425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109800] [ENSMUST00000129377]
Predicted Effect probably damaging
Transcript: ENSMUST00000109800
AA Change: I129F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105425
Gene: ENSMUSG00000027474
AA Change: I129F

DomainStartEndE-ValueType
Blast:PTB 60 160 9e-16 BLAST
low complexity region 163 184 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
internal_repeat_1 236 251 1.67e-6 PROSPERO
low complexity region 252 261 N/A INTRINSIC
internal_repeat_1 262 280 1.67e-6 PROSPERO
low complexity region 372 389 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127898
Predicted Effect possibly damaging
Transcript: ENSMUST00000129377
AA Change: I128F

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122732
Gene: ENSMUSG00000027474
AA Change: I128F

DomainStartEndE-ValueType
Blast:PTB 60 136 7e-9 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit delayed wound healing and show impaired tumor growth, poor tumor vascularization, and decreased metastatic potential following injection of Lewis Lung Carcinoma (LLC) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Ccm2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Ccm2l APN 2 153080901 splice site probably benign
IGL01826:Ccm2l APN 2 153067933 splice site probably benign
IGL02821:Ccm2l APN 2 153067859 missense probably damaging 1.00
IGL02961:Ccm2l APN 2 153078601 missense probably benign 0.03
IGL03237:Ccm2l APN 2 153066002 utr 5 prime probably benign
R0103:Ccm2l UTSW 2 153067919 nonsense probably null
R0103:Ccm2l UTSW 2 153067919 nonsense probably null
R0420:Ccm2l UTSW 2 153070862 missense probably null 0.08
R0617:Ccm2l UTSW 2 153070900 missense probably damaging 0.99
R0760:Ccm2l UTSW 2 153072184 missense probably damaging 0.99
R4787:Ccm2l UTSW 2 153079502 missense probably benign 0.00
R7106:Ccm2l UTSW 2 153070651 missense possibly damaging 0.45
R7159:Ccm2l UTSW 2 153070867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCCTGCATTAACTCAGAGGC -3'
(R):5'- TTGCTGACCTGAAACCTCCAAGAC -3'

Sequencing Primer
(F):5'- AGAGGCTAGAATCTCCCATTTC -3'
(R):5'- TACTGTCAGATCAGAGTCAAGC -3'
Posted On2014-02-18