Incidental Mutation 'R1309:Dhx37'
ID157877
Institutional Source Beutler Lab
Gene Symbol Dhx37
Ensembl Gene ENSMUSG00000029480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 37
SynonymsLOC381671, LOC208144
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R1309 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location125413858-125434121 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 125417438 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 944 (W944*)
Ref Sequence ENSEMBL: ENSMUSP00000131734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169485]
Predicted Effect probably null
Transcript: ENSMUST00000169485
AA Change: W944*
SMART Domains Protein: ENSMUSP00000131734
Gene: ENSMUSG00000029480
AA Change: W944*

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
DEXDc 246 438 3.55e-27 SMART
AAA 263 463 9.3e-3 SMART
HELICc 554 669 1.56e-14 SMART
Blast:DEXDc 678 717 1e-10 BLAST
HA2 729 852 3.32e-25 SMART
Pfam:OB_NTP_bind 886 1004 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196444
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Dhx37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Dhx37 APN 5 125419088 missense possibly damaging 0.84
IGL02010:Dhx37 APN 5 125418713 missense possibly damaging 0.58
IGL02412:Dhx37 APN 5 125431628 missense probably damaging 0.98
IGL02484:Dhx37 APN 5 125419337 missense possibly damaging 0.89
IGL02986:Dhx37 APN 5 125419315 missense probably damaging 1.00
FR4304:Dhx37 UTSW 5 125427530 unclassified probably benign
R0010:Dhx37 UTSW 5 125431616 missense probably benign 0.02
R0019:Dhx37 UTSW 5 125430034 missense probably benign 0.36
R0485:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R0959:Dhx37 UTSW 5 125423432 missense probably benign
R1101:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R1132:Dhx37 UTSW 5 125421039 missense probably damaging 0.96
R1777:Dhx37 UTSW 5 125429931 missense probably benign
R2001:Dhx37 UTSW 5 125427464 missense probably damaging 1.00
R2116:Dhx37 UTSW 5 125421102 missense probably damaging 0.98
R3826:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3829:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3830:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R4007:Dhx37 UTSW 5 125424931 splice site probably benign
R5058:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R5158:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R5436:Dhx37 UTSW 5 125429803 missense probably benign
R5789:Dhx37 UTSW 5 125421039 missense possibly damaging 0.55
R5834:Dhx37 UTSW 5 125425730 missense probably damaging 1.00
R6066:Dhx37 UTSW 5 125424666 missense probably benign 0.18
R6490:Dhx37 UTSW 5 125419132 missense probably benign 0.00
R6967:Dhx37 UTSW 5 125422167 missense probably benign 0.07
R7101:Dhx37 UTSW 5 125424942 nonsense probably null
Z1088:Dhx37 UTSW 5 125416591 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCTGAACAGTGAAGCCAGGTTG -3'
(R):5'- AGCCCAAGTGCCAGGTGATTTC -3'

Sequencing Primer
(F):5'- TCACCTGCTCTTTGCTGGAA -3'
(R):5'- CCAGGTGATTTCCTGAAGGAC -3'
Posted On2014-02-18