Incidental Mutation 'R1309:Kera'
ID157883
Institutional Source Beutler Lab
Gene Symbol Kera
Ensembl Gene ENSMUSG00000019932
Gene Namekeratocan
SynonymsSLRR2B, CNA2
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1309 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location97606879-97613692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97609426 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 216 (T216A)
Ref Sequence ENSEMBL: ENSMUSP00000100923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105286
AA Change: T216A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: T216A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 42 76 1.9e-14 SMART
LRR 71 90 2.5e-1 SMART
LRR 121 140 2.1e-1 SMART
LRR 142 161 1.5e0 SMART
LRR 166 191 3.4e-2 SMART
LRR 192 215 2.8e-2 SMART
LRR 213 232 9.2e-1 SMART
Blast:LRR 237 261 4e-8 BLAST
LRR 262 281 6.3e-2 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Kera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kera APN 10 97609077 missense possibly damaging 0.79
R1830:Kera UTSW 10 97609147 missense probably benign 0.29
R1895:Kera UTSW 10 97609147 missense probably benign 0.29
R1946:Kera UTSW 10 97609147 missense probably benign 0.29
R2365:Kera UTSW 10 97608943 missense probably benign 0.44
R3957:Kera UTSW 10 97612845 missense probably benign
R4198:Kera UTSW 10 97612973 makesense probably null
R4624:Kera UTSW 10 97609631 missense probably benign 0.00
R4625:Kera UTSW 10 97609631 missense probably benign 0.00
R4628:Kera UTSW 10 97609631 missense probably benign 0.00
R4629:Kera UTSW 10 97609631 missense probably benign 0.00
R4640:Kera UTSW 10 97612887 missense probably damaging 1.00
R6496:Kera UTSW 10 97612810 missense probably benign
R6767:Kera UTSW 10 97609172 missense possibly damaging 0.92
R6999:Kera UTSW 10 97608952 missense probably damaging 1.00
R7017:Kera UTSW 10 97609077 missense possibly damaging 0.79
R7117:Kera UTSW 10 97612852 missense probably benign
R7519:Kera UTSW 10 97609022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTCAGGGGACCTTCAGTAATC -3'
(R):5'- TGCTATTCCTACACAGGGCAGAGAC -3'

Sequencing Primer
(F):5'- GACCTTCAGTAATCTGGAAAACCTG -3'
(R):5'- GGTCACAGGCACATCTTTATG -3'
Posted On2014-02-18