Incidental Mutation 'R1309:Asb2'
ID157884
Institutional Source Beutler Lab
Gene Symbol Asb2
Ensembl Gene ENSMUSG00000021200
Gene Nameankyrin repeat and SOCS box-containing 2
Synonyms
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1309 (G1)
Quality Score137
Status Not validated
Chromosome12
Chromosomal Location103321142-103356001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103325408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 372 (V372A)
Ref Sequence ENSEMBL: ENSMUSP00000117595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021617] [ENSMUST00000149431]
Predicted Effect probably benign
Transcript: ENSMUST00000021617
AA Change: V420A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021617
Gene: ENSMUSG00000021200
AA Change: V420A

DomainStartEndE-ValueType
UIM 26 45 1.02e0 SMART
ANK 104 133 1.81e2 SMART
ANK 137 167 5.45e-2 SMART
ANK 171 200 5.45e-2 SMART
ANK 204 233 2.21e-2 SMART
ANK 237 266 9.13e-4 SMART
ANK 270 299 7.42e-4 SMART
ANK 303 332 1.19e-2 SMART
ANK 336 365 5.67e0 SMART
ANK 368 397 6.02e-4 SMART
ANK 410 439 3.54e-1 SMART
ANK 440 469 6.81e-3 SMART
SOCS_box 592 631 2.51e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127447
Predicted Effect probably benign
Transcript: ENSMUST00000149431
AA Change: V372A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117595
Gene: ENSMUSG00000021200
AA Change: V372A

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
ANK 56 85 1.81e2 SMART
ANK 89 119 5.45e-2 SMART
ANK 123 152 5.45e-2 SMART
ANK 156 185 2.21e-2 SMART
ANK 189 218 9.13e-4 SMART
ANK 222 251 7.42e-4 SMART
ANK 255 284 1.19e-2 SMART
ANK 288 317 5.67e0 SMART
ANK 320 349 6.02e-4 SMART
ANK 362 391 3.54e-1 SMART
ANK 392 421 6.81e-3 SMART
SOCS_box 544 583 2.51e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeat and SOCS box-containing (ASB) protein family. These proteins play a role in protein degradation by coupling suppressor of cytokine signalling (SOCS) proteins with the elongin BC complex. The encoded protein is a subunit of a multimeric E3 ubiquitin ligase complex that mediates the degradation of actin-binding proteins. This gene plays a role in retinoic acid-induced growth inhibition and differentiation of myeloid leukemia cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a conditional cells activated in the immune system exhibit impaired immature dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Asb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Asb2 APN 12 103335905 missense possibly damaging 0.93
IGL01878:Asb2 APN 12 103321663 missense possibly damaging 0.89
IGL02103:Asb2 APN 12 103333496 nonsense probably null
IGL02936:Asb2 APN 12 103335914 missense probably benign 0.04
R0178:Asb2 UTSW 12 103325552 missense probably damaging 1.00
R0208:Asb2 UTSW 12 103325271 missense possibly damaging 0.77
R0844:Asb2 UTSW 12 103325546 missense probably damaging 1.00
R2931:Asb2 UTSW 12 103334887 missense probably damaging 1.00
R4057:Asb2 UTSW 12 103325394 missense probably benign
R4735:Asb2 UTSW 12 103325058 missense probably benign 0.43
R4754:Asb2 UTSW 12 103323837 missense possibly damaging 0.95
R5916:Asb2 UTSW 12 103323876 missense probably damaging 1.00
R5946:Asb2 UTSW 12 103321555 missense probably benign 0.00
R6349:Asb2 UTSW 12 103345859 start codon destroyed probably null 0.07
R6605:Asb2 UTSW 12 103345684 missense probably benign 0.02
R7317:Asb2 UTSW 12 103333357 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGACAGGCACTTCATGGCAAAC -3'
(R):5'- TTTCAGAACTCACCAGCCAGTTCC -3'

Sequencing Primer
(F):5'- CTTCATGGCAAACATGATGGTG -3'
(R):5'- CGTCCTCTTACAGAATAGTGCAG -3'
Posted On2014-02-18