Incidental Mutation 'R1309:Olfr1368'
ID157886
Institutional Source Beutler Lab
Gene Symbol Olfr1368
Ensembl Gene ENSMUSG00000045474
Gene Nameolfactory receptor 1368
SynonymsMOR256-15, GA_x6K02T2QHY8-12104556-12105500
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1309 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21141882-21145867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21142167 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
Predicted Effect probably benign
Transcript: ENSMUST00000055298
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: V297I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206267
Predicted Effect probably benign
Transcript: ENSMUST00000216039
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Olfr1368
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Olfr1368 APN 13 21142484 missense probably damaging 1.00
IGL03385:Olfr1368 APN 13 21142487 missense probably benign 0.01
R0137:Olfr1368 UTSW 13 21142166 missense possibly damaging 0.86
R1168:Olfr1368 UTSW 13 21142617 missense probably benign 0.04
R1212:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1214:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1237:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1238:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1239:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1280:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1436:Olfr1368 UTSW 13 21142992 missense probably benign 0.01
R1443:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1444:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1602:Olfr1368 UTSW 13 21142650 missense probably damaging 0.99
R1627:Olfr1368 UTSW 13 21142955 missense probably damaging 0.99
R1649:Olfr1368 UTSW 13 21142742 missense probably damaging 1.00
R1781:Olfr1368 UTSW 13 21142764 missense probably benign 0.08
R1858:Olfr1368 UTSW 13 21142394 missense probably damaging 1.00
R2520:Olfr1368 UTSW 13 21142576 nonsense probably null
R4873:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R4875:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R5009:Olfr1368 UTSW 13 21142265 missense probably benign 0.01
R6222:Olfr1368 UTSW 13 21142877 missense probably damaging 1.00
R7031:Olfr1368 UTSW 13 21143000 missense probably benign
R7126:Olfr1368 UTSW 13 21142718 missense probably damaging 1.00
R7691:Olfr1368 UTSW 13 21142970 missense probably benign
R7875:Olfr1368 UTSW 13 21142923 missense probably damaging 1.00
R8015:Olfr1368 UTSW 13 21142133 missense probably benign
R8155:Olfr1368 UTSW 13 21142892 missense probably damaging 1.00
R8247:Olfr1368 UTSW 13 21142125 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGGGAAATGGTCCTGAATGAAC -3'
(R):5'- ACCCTGTGCTTTGCCAGAAGATG -3'

Sequencing Primer
(F):5'- CTGATCTGCCACTATGACAAGGG -3'
(R):5'- GCAGTTATCACTCAAGCTGTG -3'
Posted On2014-02-18