Incidental Mutation 'R1309:Stk24'
ID157888
Institutional Source Beutler Lab
Gene Symbol Stk24
Ensembl Gene ENSMUSG00000063410
Gene Nameserine/threonine kinase 24
SynonymsSTE20, 1810013H02Rik
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1309 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121286343-121380011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121302786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 134 (Y134H)
Ref Sequence ENSEMBL: ENSMUSP00000078746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079817]
Predicted Effect probably damaging
Transcript: ENSMUST00000079817
AA Change: Y134H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078746
Gene: ENSMUSG00000063410
AA Change: Y134H

DomainStartEndE-ValueType
S_TKc 24 274 3.18e-99 SMART
low complexity region 297 324 N/A INTRINSIC
PDB:3W8H|B 356 422 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227273
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that functions upstream of mitogen-activated protein kinase (MAPK) signaling. The encoded protein is cleaved into two chains by caspases; the N-terminal fragment (MST3/N) translocates to the nucleus and promotes programmed cells death. There is a pseudogene for this gene on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: A hypomorphic mutation increases degranulation of, and exocytosis by, neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Lmnb1 CAGAGAGAGAGAGA CAGAGAGAGAGA 18: 56,739,904 probably null Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Stk24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Stk24 APN 14 121302806 missense probably damaging 1.00
IGL02886:Stk24 APN 14 121292115 missense probably null 1.00
IGL03278:Stk24 APN 14 121302770 missense possibly damaging 0.88
Megatron UTSW 14 121308007 splice site probably benign
R0018:Stk24 UTSW 14 121308007 splice site probably benign
R1446:Stk24 UTSW 14 121308044 missense probably damaging 1.00
R1567:Stk24 UTSW 14 121308056 missense probably benign 0.00
R1673:Stk24 UTSW 14 121337571 missense probably damaging 1.00
R2131:Stk24 UTSW 14 121302211 missense probably damaging 1.00
R4302:Stk24 UTSW 14 121292082 missense probably benign 0.07
R4716:Stk24 UTSW 14 121294718 missense possibly damaging 0.85
R4865:Stk24 UTSW 14 121293454 nonsense probably null
R5381:Stk24 UTSW 14 121294233 missense possibly damaging 0.80
R5540:Stk24 UTSW 14 121294281 missense possibly damaging 0.69
R6017:Stk24 UTSW 14 121302245 missense probably benign 0.15
R6913:Stk24 UTSW 14 121302809 missense probably damaging 1.00
R7081:Stk24 UTSW 14 121294294 missense probably benign 0.01
R7251:Stk24 UTSW 14 121308022 missense probably damaging 1.00
R7586:Stk24 UTSW 14 121302287 missense probably damaging 0.99
R7587:Stk24 UTSW 14 121302287 missense probably damaging 0.99
R7771:Stk24 UTSW 14 121337633 missense probably damaging 1.00
RF008:Stk24 UTSW 14 121294760 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGAGGACCCCTAAGAGCAAGCTG -3'
(R):5'- CATCCGTTTATCCATCCACACCAGG -3'

Sequencing Primer
(F):5'- gtggcacacggctttaac -3'
(R):5'- AGTTAGAGCCTGGCCCTTTA -3'
Posted On2014-02-18