Incidental Mutation 'R1309:Lmnb1'
ID157891
Institutional Source Beutler Lab
Gene Symbol Lmnb1
Ensembl Gene ENSMUSG00000024590
Gene Namelamin B1
Synonyms
MMRRC Submission 039375-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1309 (G1)
Quality Score103
Status Not validated
Chromosome18
Chromosomal Location56707813-56753424 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGAGAGAGA to CAGAGAGAGAGA at 56739904 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025486]
Predicted Effect probably null
Transcript: ENSMUST00000025486
SMART Domains Protein: ENSMUSP00000025486
Gene: ENSMUSG00000024590

DomainStartEndE-ValueType
Filament 32 388 2.59e-47 SMART
low complexity region 392 414 N/A INTRINSIC
Pfam:LTD 436 546 2.3e-18 PFAM
low complexity region 551 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two B-type lamin proteins and is a component of the nuclear lamina. A duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory distress, abnormal lung, craniofacial, and skeletal morphology, reduced embryo size, impaired cellular proliferation and differentiation, and abnormal nuclear morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Angptl2 G A 2: 33,246,128 A442T probably benign Het
Ankar T C 1: 72,674,004 I709V possibly damaging Het
Asb2 A G 12: 103,325,408 V372A probably benign Het
Ccm2l A T 2: 153,070,924 I129F probably damaging Het
Cdkal1 T A 13: 29,357,583 I433F possibly damaging Het
Cpsf7 T C 19: 10,533,467 probably null Het
Dhx37 C T 5: 125,417,438 W944* probably null Het
Dip2a A G 10: 76,279,776 L939P probably damaging Het
Kera A G 10: 97,609,426 T216A possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Prep A G 10: 45,126,026 T426A probably benign Het
Rxfp1 C T 3: 79,663,292 probably null Het
Spag6 A G 2: 18,734,216 Y319C probably damaging Het
Stk24 A G 14: 121,302,786 Y134H probably damaging Het
Tdrd6 T C 17: 43,626,621 I1179V probably benign Het
Tedc1 A G 12: 113,161,780 E274G probably benign Het
Zswim2 A T 2: 83,938,756 F87Y probably damaging Het
Other mutations in Lmnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Lmnb1 APN 18 56740796 missense probably benign 0.37
IGL02139:Lmnb1 APN 18 56749799 missense probably benign 0.00
Katmai UTSW 18 56743276 nonsense probably null
R0446:Lmnb1 UTSW 18 56743259 missense probably benign 0.02
R0696:Lmnb1 UTSW 18 56740721 missense probably damaging 0.99
R1308:Lmnb1 UTSW 18 56728475 missense probably benign 0.06
R1544:Lmnb1 UTSW 18 56749751 missense probably benign 0.08
R2680:Lmnb1 UTSW 18 56731105 missense probably damaging 1.00
R3833:Lmnb1 UTSW 18 56728526 missense probably benign 0.01
R3980:Lmnb1 UTSW 18 56731019 missense probably damaging 1.00
R5820:Lmnb1 UTSW 18 56740786 missense possibly damaging 0.70
R6025:Lmnb1 UTSW 18 56729384 nonsense probably null
R6028:Lmnb1 UTSW 18 56743276 nonsense probably null
R6346:Lmnb1 UTSW 18 56743238 missense probably benign 0.24
R6736:Lmnb1 UTSW 18 56728469 missense probably damaging 1.00
R8013:Lmnb1 UTSW 18 56708359 missense probably damaging 1.00
RF004:Lmnb1 UTSW 18 56730974 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAGCTGCCTTGTGCTCATGGTGAC -3'
(R):5'- GGGCTGTTCTTTACCTGAGTGAACC -3'

Sequencing Primer
(F):5'- CATGGTCCTAGAAAGTCAATGTGC -3'
(R):5'- GTGAACCAGAATCTTACTCTGATGC -3'
Posted On2014-02-18