Mutagenetix > Incidental Mutation

Incidental Mutation 'R1309:Cpsf7'

157892

Institutional Source

Beutler Lab

Gene Symbol

Cpsf7

Ensembl Gene

ENSMUSG00000034820

Gene Name

cleavage and polyadenylation specific factor 7

Synonyms

5730453I16Rik, C330017N18Rik

MMRRC Submission

039375-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1309 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10502630-10525017 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 10510831 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038379] [ENSMUST00000038379] [ENSMUST00000145210]

AlphaFold

Q8BTV2

Predicted Effect

probably null
Transcript: ENSMUST00000038379

SMART Domains

Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820

Domain	Start	End	E-Value	Type
low complexity region	51	63	N/A	INTRINSIC
RRM	83	158	7.31e-8	SMART
low complexity region	188	202	N/A	INTRINSIC
low complexity region	228	260	N/A	INTRINSIC
low complexity region	265	291	N/A	INTRINSIC
low complexity region	346	362	N/A	INTRINSIC
low complexity region	405	439	N/A	INTRINSIC
low complexity region	454	471	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000038379

SMART Domains

Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820

Domain	Start	End	E-Value	Type
low complexity region	51	63	N/A	INTRINSIC
RRM	83	158	7.31e-8	SMART
low complexity region	188	202	N/A	INTRINSIC
low complexity region	228	260	N/A	INTRINSIC
low complexity region	265	291	N/A	INTRINSIC
low complexity region	346	362	N/A	INTRINSIC
low complexity region	405	439	N/A	INTRINSIC
low complexity region	454	471	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145210

SMART Domains

Protein: ENSMUSP00000123397
Gene: ENSMUSG00000024667

Domain	Start	End	E-Value	Type
Pfam:Transmemb_17	1	69	2.8e-21	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,262,287 (GRCm39)	E148K	probably damaging	Het
Angptl2	G	A	2: 33,136,140 (GRCm39)	A442T	probably benign	Het
Ankar	T	C	1: 72,713,163 (GRCm39)	I709V	possibly damaging	Het
Asb2	A	G	12: 103,291,667 (GRCm39)	V372A	probably benign	Het
Ccm2l	A	T	2: 152,912,844 (GRCm39)	I129F	probably damaging	Het
Cdkal1	T	A	13: 29,541,566 (GRCm39)	I433F	possibly damaging	Het
Dhx37	C	T	5: 125,494,502 (GRCm39)	W944*	probably null	Het
Dip2a	A	G	10: 76,115,610 (GRCm39)	L939P	probably damaging	Het
Kera	A	G	10: 97,445,288 (GRCm39)	T216A	possibly damaging	Het
Lmnb1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	18: 56,872,976 (GRCm39)		probably null	Het
Or2ad1	C	T	13: 21,326,337 (GRCm39)	V297I	probably benign	Het
Prep	A	G	10: 45,002,122 (GRCm39)	T426A	probably benign	Het
Rxfp1	C	T	3: 79,570,599 (GRCm39)		probably null	Het
Spag6	A	G	2: 18,739,027 (GRCm39)	Y319C	probably damaging	Het
Stk24	A	G	14: 121,540,198 (GRCm39)	Y134H	probably damaging	Het
Tdrd6	T	C	17: 43,937,512 (GRCm39)	I1179V	probably benign	Het
Tedc1	A	G	12: 113,125,400 (GRCm39)	E274G	probably benign	Het
Zswim2	A	T	2: 83,769,100 (GRCm39)	F87Y	probably damaging	Het

Other mutations in Cpsf7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Cpsf7	APN	19	10,517,151 (GRCm39)	missense	probably damaging	0.98
IGL00870:Cpsf7	APN	19	10,517,014 (GRCm39)	splice site	probably null
IGL01883:Cpsf7	APN	19	10,503,387 (GRCm39)	missense	possibly damaging	0.69
IGL02406:Cpsf7	APN	19	10,509,352 (GRCm39)	missense	probably damaging	0.96
IGL02491:Cpsf7	APN	19	10,517,001 (GRCm39)	missense	possibly damaging	0.92
IGL02990:Cpsf7	APN	19	10,509,159 (GRCm39)	missense	probably benign
R0003:Cpsf7	UTSW	19	10,516,993 (GRCm39)	missense	possibly damaging	0.88
R0540:Cpsf7	UTSW	19	10,510,682 (GRCm39)	nonsense	probably null
R0633:Cpsf7	UTSW	19	10,509,146 (GRCm39)	missense	probably benign	0.09
R0662:Cpsf7	UTSW	19	10,503,372 (GRCm39)	start codon destroyed	probably null	0.77
R1817:Cpsf7	UTSW	19	10,512,803 (GRCm39)	missense	possibly damaging	0.89
R2004:Cpsf7	UTSW	19	10,518,073 (GRCm39)	missense	probably damaging	1.00
R2286:Cpsf7	UTSW	19	10,512,660 (GRCm39)	missense	probably damaging	0.99
R2417:Cpsf7	UTSW	19	10,503,332 (GRCm39)	start gained	probably benign
R4374:Cpsf7	UTSW	19	10,517,001 (GRCm39)	missense	probably damaging	1.00
R5788:Cpsf7	UTSW	19	10,518,082 (GRCm39)	missense	possibly damaging	0.88
R5801:Cpsf7	UTSW	19	10,516,996 (GRCm39)	missense	probably benign	0.02
R6823:Cpsf7	UTSW	19	10,510,248 (GRCm39)	nonsense	probably null
R7371:Cpsf7	UTSW	19	10,509,203 (GRCm39)	missense	probably benign	0.00
R7602:Cpsf7	UTSW	19	10,512,737 (GRCm39)	missense	probably damaging	0.99
R8185:Cpsf7	UTSW	19	10,514,224 (GRCm39)	nonsense	probably null
R8935:Cpsf7	UTSW	19	10,509,345 (GRCm39)	nonsense	probably null
R9450:Cpsf7	UTSW	19	10,518,213 (GRCm39)	critical splice donor site	probably null
Z1177:Cpsf7	UTSW	19	10,512,882 (GRCm39)	missense	probably null	0.83

Predicted Primers

PCR Primer
(F):5'- AGGTGGTGGTAGCCTCTGAAAATTCTG -3'
(R):5'- AGCAAGCCCATTCATGGTGTGTCC -3'

Sequencing Primer
(F):5'- AATTCTGTCCACAAACTGCTGG -3'
(R):5'- agggcagaacggacaac -3'

Posted On

2014-02-18