Incidental Mutation 'R1310:Yod1'
ID157894
Institutional Source Beutler Lab
Gene Symbol Yod1
Ensembl Gene ENSMUSG00000046404
Gene NameYOD1 deubiquitinase
Synonyms9930028C20Rik
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130717327-130724358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130718830 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 148 (A148V)
Ref Sequence ENSEMBL: ENSMUSP00000055318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049813] [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
PDB Structure
Solution NMR Structure of Ubiquitin thioesterase OTU1 (EC 3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000049813
AA Change: A148V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055318
Gene: ENSMUSG00000046404
AA Change: A148V

DomainStartEndE-ValueType
PDB:2KZR|A 42 127 3e-54 PDB
Blast:UBQ 43 118 2e-20 BLAST
Pfam:OTU 150 268 3.4e-8 PFAM
ZnF_C2H2 313 337 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050406
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066863
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169659
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171479
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185233
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably benign
Transcript: ENSMUST00000187089
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188520
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189167
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189534
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191301
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191347
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Yod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Yod1 APN 1 130719133 missense probably damaging 1.00
IGL02321:Yod1 APN 1 130718951 missense probably damaging 1.00
IGL03018:Yod1 APN 1 130718958 missense probably benign 0.08
R5825:Yod1 UTSW 1 130719006 missense probably damaging 1.00
R6115:Yod1 UTSW 1 130719063 missense possibly damaging 0.48
R6367:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6437:Yod1 UTSW 1 130719148 missense probably damaging 1.00
R6489:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6491:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6729:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6731:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6732:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6742:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6743:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6766:Yod1 UTSW 1 130719271 nonsense probably null
R6781:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R7831:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R7914:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R8058:Yod1 UTSW 1 130719069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTAAGTTGAAATGCAGCGCGGAG -3'
(R):5'- CGGATCGTAGTGAATGCCATCGTAG -3'

Sequencing Primer
(F):5'- CAAACTTAGAGAGTTACTGGCCTC -3'
(R):5'- ACGATCAATTCTGACTGTCTGTG -3'
Posted On2014-02-18