Incidental Mutation 'R1310:Olfr1265'
ID157896
Institutional Source Beutler Lab
Gene Symbol Olfr1265
Ensembl Gene ENSMUSG00000059910
Gene Nameolfactory receptor 1265
SynonymsGA_x6K02T2Q125-51469027-51469956, MOR228-2
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90035337-90042214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90037703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 261 (D261E)
Ref Sequence ENSEMBL: ENSMUSP00000149684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080311] [ENSMUST00000214855]
Predicted Effect probably benign
Transcript: ENSMUST00000080311
AA Change: D261E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079190
Gene: ENSMUSG00000059910
AA Change: D261E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-49 PFAM
Pfam:7tm_1 39 285 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214855
AA Change: D261E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Olfr1265
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Olfr1265 APN 2 90037468 missense probably damaging 1.00
IGL01470:Olfr1265 APN 2 90037818 missense possibly damaging 0.81
IGL01878:Olfr1265 APN 2 90037134 missense probably damaging 0.97
IGL02716:Olfr1265 APN 2 90037794 missense probably benign 0.05
IGL03066:Olfr1265 APN 2 90037434 missense probably damaging 0.99
R4986:Olfr1265 UTSW 2 90037428 missense probably damaging 1.00
R5101:Olfr1265 UTSW 2 90037047 missense probably benign 0.00
R6149:Olfr1265 UTSW 2 90037516 missense probably benign 0.01
R6400:Olfr1265 UTSW 2 90037395 missense probably benign 0.00
R7367:Olfr1265 UTSW 2 90037812 missense probably benign 0.02
R7432:Olfr1265 UTSW 2 90037184 missense probably damaging 0.99
R7645:Olfr1265 UTSW 2 90037747 missense possibly damaging 0.90
R7849:Olfr1265 UTSW 2 90037282 missense probably damaging 1.00
R7932:Olfr1265 UTSW 2 90037282 missense probably damaging 1.00
X0019:Olfr1265 UTSW 2 90037644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCTGTCAGTGATCAGCTTTGTGG -3'
(R):5'- ATGAGCAGTCCTTTCCCTCAGTGC -3'

Sequencing Primer
(F):5'- GTGGTCCTCTTAGCATCCTATGTG -3'
(R):5'- TCAGTGCCCATCAGTTTGG -3'
Posted On2014-02-18