Incidental Mutation 'R1310:Bcl10'
ID157897
Institutional Source Beutler Lab
Gene Symbol Bcl10
Ensembl Gene ENSMUSG00000028191
Gene NameB cell leukemia/lymphoma 10
SynonymsmE10, cE10, BCL-10
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145922804-145934356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 145930425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 26 (V26G)
Ref Sequence ENSEMBL: ENSMUSP00000029842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029842]
Predicted Effect probably damaging
Transcript: ENSMUST00000029842
AA Change: V26G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029842
Gene: ENSMUSG00000028191
AA Change: V26G

DomainStartEndE-ValueType
Pfam:CARD 18 102 8e-20 PFAM
low complexity region 192 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198122
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: About one-third of homozygous null embryos die exhibiting exencephaly. Surviving mutants display immunological defects including severe immunodeficiency, abnormal B cell development and function, and impaired humoral response to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Bcl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Bcl10 APN 3 145933184 nonsense probably null
Derek UTSW 3 145930587 missense probably damaging 1.00
R1161:Bcl10 UTSW 3 145930425 missense probably damaging 0.99
R2570:Bcl10 UTSW 3 145933030 missense probably benign 0.13
R4669:Bcl10 UTSW 3 145930572 missense probably damaging 1.00
R5301:Bcl10 UTSW 3 145930587 missense probably damaging 1.00
R5691:Bcl10 UTSW 3 145933149 missense probably benign 0.03
R7008:Bcl10 UTSW 3 145933299 missense probably benign 0.05
R7384:Bcl10 UTSW 3 145933040 missense possibly damaging 0.90
R7853:Bcl10 UTSW 3 145924511 missense possibly damaging 0.90
R7936:Bcl10 UTSW 3 145924511 missense possibly damaging 0.90
Z1176:Bcl10 UTSW 3 145930513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCACACTAAGTTGTCCTGGTCC -3'
(R):5'- CCAAATGGTGGTGGTTTTAAGAGCG -3'

Sequencing Primer
(F):5'- TGCTGCTGGGCATCATC -3'
(R):5'- CCGTTATCTTCTGAATCAGGAAGC -3'
Posted On2014-02-18