Incidental Mutation 'R1310:C87436'
ID157902
Institutional Source Beutler Lab
Gene Symbol C87436
Ensembl Gene ENSMUSG00000046679
Gene Nameexpressed sequence C87436
Synonyms
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86438374-86473500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86445450 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000115916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050497] [ENSMUST00000113698] [ENSMUST00000113700] [ENSMUST00000133753] [ENSMUST00000141972] [ENSMUST00000203568] [ENSMUST00000204137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050497
AA Change: E2G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057461
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1.1e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113698
AA Change: E2G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109328
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 1e-22 PFAM
low complexity region 278 290 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113700
AA Change: E2G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109330
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 16 57 1.3e-22 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133753
AA Change: E2G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121520
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141972
AA Change: E2G

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115916
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 15 58 6.2e-23 PFAM
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203568
AA Change: E2G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144724
Gene: ENSMUSG00000046679
AA Change: E2G

DomainStartEndE-ValueType
Pfam:zf-tcix 16 57 3.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in C87436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:C87436 APN 6 86457855 missense probably damaging 1.00
IGL01596:C87436 APN 6 86446219 missense probably damaging 1.00
IGL02039:C87436 APN 6 86453695 missense probably benign 0.40
IGL02798:C87436 APN 6 86446202 missense probably benign 0.01
R0008:C87436 UTSW 6 86446283 unclassified probably benign
R0128:C87436 UTSW 6 86469827 missense probably damaging 1.00
R0445:C87436 UTSW 6 86449850 missense possibly damaging 0.77
R0970:C87436 UTSW 6 86447328 missense probably damaging 0.99
R1125:C87436 UTSW 6 86447362 missense probably benign 0.00
R1640:C87436 UTSW 6 86446251 missense probably damaging 0.99
R1764:C87436 UTSW 6 86453612 missense possibly damaging 0.92
R2213:C87436 UTSW 6 86445473 missense probably benign 0.04
R2275:C87436 UTSW 6 86445600 missense probably damaging 1.00
R3947:C87436 UTSW 6 86446186 missense probably damaging 1.00
R5416:C87436 UTSW 6 86465850 missense probably damaging 1.00
R5604:C87436 UTSW 6 86447355 missense probably benign 0.01
R5982:C87436 UTSW 6 86445975 missense possibly damaging 0.87
R6171:C87436 UTSW 6 86445467 missense probably benign 0.04
R6744:C87436 UTSW 6 86446064 missense probably damaging 1.00
R7215:C87436 UTSW 6 86462680 missense possibly damaging 0.80
R7253:C87436 UTSW 6 86465808 missense probably damaging 1.00
R7876:C87436 UTSW 6 86446429 intron probably null
R7959:C87436 UTSW 6 86446429 intron probably null
R8035:C87436 UTSW 6 86447355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGGGCAGCTACACAGCTT -3'
(R):5'- GCACCATAGCGAAATATGGTTCCACA -3'

Sequencing Primer
(F):5'- tctctctctcttctctctctcc -3'
(R):5'- CGAAATATGGTTCCACATGTCTTG -3'
Posted On2014-02-18