Incidental Mutation 'R1310:Sik3'
ID157908
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
Synonyms
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1310 (G1)
Quality Score223
Status Not validated
Chromosome9
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46219426 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1170 (E1170G)
Ref Sequence ENSEMBL: ENSMUSP00000112749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: E1064G
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: E1064G

DomainStartEndE-ValueType
S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120463
AA Change: E1170G

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: E1170G

DomainStartEndE-ValueType
low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126865
AA Change: E1220G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: E1220G

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0119:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0344:Sik3 UTSW 9 46208811 missense probably damaging 0.97
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1017:Sik3 UTSW 9 46195809 missense probably benign 0.00
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1884:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6540:Sik3 UTSW 9 46212053 missense probably benign
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
R7830:Sik3 UTSW 9 46212057 small deletion probably benign
R7875:Sik3 UTSW 9 46123230 missense probably damaging 1.00
R7958:Sik3 UTSW 9 46123230 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCACAAGCTAAGCCAGCAG -3'
(R):5'- GCCAACATACATAGGCATCGTCGC -3'

Sequencing Primer
(F):5'- GGTAAGGAGTGTCTTAAACCCC -3'
(R):5'- ATAGGCATCGTCGCTGTTC -3'
Posted On2014-02-18