Incidental Mutation 'R1310:Eme1'
ID157910
Institutional Source Beutler Lab
Gene Symbol Eme1
Ensembl Gene ENSMUSG00000039055
Gene Nameessential meiotic structure-specific endonuclease 1
Synonyms
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94644996-94653964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94645542 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 534 (R534C)
Ref Sequence ENSEMBL: ENSMUSP00000036361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021239] [ENSMUST00000039949]
Predicted Effect probably benign
Transcript: ENSMUST00000021239
SMART Domains Protein: ENSMUSP00000021239
Gene: ENSMUSG00000020869

DomainStartEndE-ValueType
LRR 38 60 6.22e0 SMART
LRR 61 83 1.33e-1 SMART
LRR 84 106 3.75e0 SMART
LRR 107 131 1.09e2 SMART
coiled coil region 148 216 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039949
AA Change: R534C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036361
Gene: ENSMUSG00000039055
AA Change: R534C

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ERCC4 252 515 2.06e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128643
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Eme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Eme1 APN 11 94645451 missense probably damaging 1.00
IGL02402:Eme1 APN 11 94650907 missense possibly damaging 0.65
R0220:Eme1 UTSW 11 94650258 missense probably null 1.00
R0594:Eme1 UTSW 11 94650430 missense possibly damaging 0.63
R0608:Eme1 UTSW 11 94650082 missense probably damaging 1.00
R0842:Eme1 UTSW 11 94650874 missense probably benign 0.24
R0925:Eme1 UTSW 11 94650732 missense probably damaging 0.99
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1161:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1837:Eme1 UTSW 11 94645961 missense probably benign 0.14
R2138:Eme1 UTSW 11 94648192 missense probably damaging 1.00
R2420:Eme1 UTSW 11 94645814 critical splice donor site probably null
R2427:Eme1 UTSW 11 94650975 unclassified probably benign
R3807:Eme1 UTSW 11 94650592 missense probably damaging 1.00
R4230:Eme1 UTSW 11 94647992 missense possibly damaging 0.69
R6889:Eme1 UTSW 11 94650477 missense probably benign 0.00
R7752:Eme1 UTSW 11 94650819 missense probably damaging 1.00
R7759:Eme1 UTSW 11 94645840 nonsense probably null
R7901:Eme1 UTSW 11 94650819 missense probably damaging 1.00
R7984:Eme1 UTSW 11 94650819 missense probably damaging 1.00
X0021:Eme1 UTSW 11 94650518 missense possibly damaging 0.56
Z1176:Eme1 UTSW 11 94650696 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCCCAGAGATGAGAGACTTGCTCC -3'
(R):5'- GGTGACCTTGCTCTCCAAACATCG -3'

Sequencing Primer
(F):5'- GATGAGAGACTTGCTCCCTAACTG -3'
(R):5'- TGAGAAAGGCCAGGTTCTCC -3'
Posted On2014-02-18