Incidental Mutation 'R1310:Drd3'
ID157912
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Namedopamine receptor D3
SynonymsD3 receptor, D3R
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location43754026-43822932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43821529 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 403 (K403E)
Ref Sequence ENSEMBL: ENSMUSP00000155033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023390
AA Change: K371E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: K371E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229953
AA Change: K403E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R3753:Drd3 UTSW 16 43817103 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5016:Drd3 UTSW 16 43762246 missense possibly damaging 0.88
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6052:Drd3 UTSW 16 43821283 missense probably benign 0.01
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7031:Drd3 UTSW 16 43762498 missense probably damaging 0.98
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
R7447:Drd3 UTSW 16 43817063 nonsense probably null
R7567:Drd3 UTSW 16 43822684 missense probably benign 0.00
R7575:Drd3 UTSW 16 43817133 missense probably benign 0.11
R7772:Drd3 UTSW 16 43762395 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAAACGCTACTACAGCATCTGCC -3'
(R):5'- CCTAATGTGTGCCACACGCTTTTG -3'

Sequencing Primer
(F):5'- AGCATCTGCCAAGACACTG -3'
(R):5'- GATAGCCCAAATTAAGTGGCTTC -3'
Posted On2014-02-18